Incidental Mutation 'R0847:Olfr1487'
ID77039
Institutional Source Beutler Lab
Gene Symbol Olfr1487
Ensembl Gene ENSMUSG00000094846
Gene Nameolfactory receptor 1487
SynonymsMOR202-18, GA_x6K02T2RE5P-3951719-3952666
MMRRC Submission 039026-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R0847 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location13617375-13623072 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 13619551 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 87 (H87Y)
Ref Sequence ENSEMBL: ENSMUSP00000146516 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076856] [ENSMUST00000208347] [ENSMUST00000209005] [ENSMUST00000216688] [ENSMUST00000217061]
Predicted Effect probably benign
Transcript: ENSMUST00000076856
AA Change: H130Y

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000076128
Gene: ENSMUSG00000094846
AA Change: H130Y

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 4.8e-55 PFAM
Pfam:7TM_GPCR_Srsx 34 304 1e-6 PFAM
Pfam:7tm_1 40 289 9.5e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208347
AA Change: H87Y

PolyPhen 2 Score 0.098 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000209005
AA Change: H87Y

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000216688
AA Change: H87Y

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000217061
AA Change: H130Y

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T C 5: 8,845,764 I899T probably damaging Het
Ahnak C T 19: 9,006,433 Q1694* probably null Het
AI314180 G A 4: 58,841,439 T645I probably benign Het
Cblc A T 7: 19,790,534 Y260* probably null Het
Ceacam5 A G 7: 17,757,837 T711A possibly damaging Het
Cep63 A G 9: 102,588,758 S690P probably benign Het
Chia1 A T 3: 106,131,937 I448F probably benign Het
Dmxl2 A T 9: 54,405,828 F1712I probably damaging Het
Exosc3 A G 4: 45,319,695 V109A probably damaging Het
Fxyd7 A G 7: 31,044,604 C60R probably damaging Het
Gm17349 C A 15: 99,702,408 probably benign Het
Gpn2 A G 4: 133,588,595 N199D probably benign Het
Ints12 C T 3: 133,108,842 T270M possibly damaging Het
Kdm4a C T 4: 118,164,498 E266K probably damaging Het
Kremen2 G T 17: 23,744,660 T50N probably damaging Het
Macf1 A T 4: 123,399,366 D1249E probably benign Het
Mdga2 T A 12: 66,723,080 K146N probably damaging Het
Med20 G A 17: 47,611,693 probably null Het
Myo18b T C 5: 112,874,488 probably benign Het
Nav3 T A 10: 109,903,857 T84S possibly damaging Het
Olfm2 A G 9: 20,668,657 V266A probably damaging Het
Olfr1453 A T 19: 13,027,731 Y199* probably null Het
Olfr810 T A 10: 129,791,458 I44F probably damaging Het
Pthlh A T 6: 147,263,268 probably null Het
Rpap3 C T 15: 97,703,201 probably null Het
Rprd2 A G 3: 95,765,413 S893P probably benign Het
Sacm1l G A 9: 123,548,862 G69D probably damaging Het
Slc27a4 T C 2: 29,811,249 S351P probably benign Het
Sobp C G 10: 43,022,419 R390P probably damaging Het
Spata7 T A 12: 98,648,430 M107K possibly damaging Het
Sri G A 5: 8,063,755 probably null Het
Stab2 T C 10: 86,969,871 I204V probably benign Het
Synm T C 7: 67,735,056 I511V probably damaging Het
Tbr1 T C 2: 61,805,029 S108P probably benign Het
Tln1 A G 4: 43,555,333 F197S probably damaging Het
Tmem167b C T 3: 108,560,221 G46R probably benign Het
Tmprss11g T C 5: 86,490,726 K301R probably benign Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Trpm2 C T 10: 77,929,288 V960M possibly damaging Het
Ube3a G A 7: 59,276,586 D371N possibly damaging Het
Vmn2r57 A T 7: 41,428,801 F78I probably benign Het
Wisp1 T G 15: 66,919,275 C309G probably damaging Het
Other mutations in Olfr1487
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01128:Olfr1487 APN 19 13619746 missense probably damaging 1.00
R0281:Olfr1487 UTSW 19 13619485 missense probably benign 0.00
R1852:Olfr1487 UTSW 19 13619603 missense probably damaging 0.99
R2026:Olfr1487 UTSW 19 13619581 missense probably damaging 1.00
R2877:Olfr1487 UTSW 19 13619632 missense probably damaging 0.97
R3965:Olfr1487 UTSW 19 13619201 missense probably damaging 1.00
R4935:Olfr1487 UTSW 19 13619702 missense probably benign 0.11
R5148:Olfr1487 UTSW 19 13619510 nonsense probably null
R5210:Olfr1487 UTSW 19 13619399 missense probably damaging 1.00
R5427:Olfr1487 UTSW 19 13619350 missense probably benign 0.31
R5940:Olfr1487 UTSW 19 13619153 unclassified probably null
R6110:Olfr1487 UTSW 19 13619885 missense probably benign 0.03
R6125:Olfr1487 UTSW 19 13619885 missense probably benign 0.03
R6294:Olfr1487 UTSW 19 13619366 missense probably benign 0.08
R7051:Olfr1487 UTSW 19 13619405 missense possibly damaging 0.94
R7052:Olfr1487 UTSW 19 13619626 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- CCCAAGGTGATGGAAGGGTTTCTC -3'
(R):5'- CAGAGCGCATTCTCAGAATTGCAAC -3'

Sequencing Primer
(F):5'- ATGGAAGGGTTTCTCACAGG -3'
(R):5'- AGCAACATTGAATGCTGCC -3'
Posted On2013-10-16