Incidental Mutation 'R0964:Gckr'
ID81462
Institutional Source Beutler Lab
Gene Symbol Gckr
Ensembl Gene ENSMUSG00000059434
Gene Nameglucokinase regulatory protein
SynonymsGKRP
MMRRC Submission 039093-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0964 (G1)
Quality Score212
Status Validated
Chromosome5
Chromosomal Location31297443-31327314 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 31326915 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144202 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072228] [ENSMUST00000201166]
Predicted Effect probably benign
Transcript: ENSMUST00000072228
SMART Domains Protein: ENSMUSP00000072084
Gene: ENSMUSG00000059434

DomainStartEndE-ValueType
PDB:4LC9|A 1 584 N/A PDB
Predicted Effect probably benign
Transcript: ENSMUST00000201166
SMART Domains Protein: ENSMUSP00000144202
Gene: ENSMUSG00000059434

DomainStartEndE-ValueType
PDB:4LC9|A 1 620 N/A PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202242
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202909
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the GCKR subfamily of the SIS (Sugar ISomerase) family of proteins. The gene product is a regulatory protein that inhibits glucokinase in liver and pancreatic islet cells by binding non-covalently to form an inactive complex with the enzyme. This gene is considered a susceptibility gene candidate for a form of maturity-onset diabetes of the young (MODY). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to reduced glucokinase protein levels and activity in the liver and altered glucose homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Acacb A T 5: 114,229,752 M1604L possibly damaging Het
Acpp A G 9: 104,326,975 V40A possibly damaging Het
Adgrl1 T C 8: 83,934,412 probably benign Het
Alppl2 C T 1: 87,087,724 V372I possibly damaging Het
Apol8 C T 15: 77,749,611 S255N probably benign Het
Atp8b4 A T 2: 126,337,493 F973I probably damaging Het
Bbs4 A G 9: 59,322,976 *150Q probably null Het
Cacna1h A T 17: 25,378,775 probably benign Het
Ccser2 C T 14: 36,909,008 probably benign Het
Chd9 A G 8: 91,015,204 E1607G probably benign Het
Clca4b A G 3: 144,915,576 I579T probably benign Het
Col20a1 T A 2: 180,984,485 probably benign Het
Creg2 T C 1: 39,624,976 I205V probably benign Het
Cyr61 C A 3: 145,647,748 C353F probably damaging Het
Ddx24 C T 12: 103,423,907 R275H probably damaging Het
Dip2c G A 13: 9,568,663 A579T probably benign Het
Dnah3 T C 7: 119,952,739 probably benign Het
Dnah8 G A 17: 30,673,920 probably null Het
Gpbp1l1 A G 4: 116,581,239 probably benign Het
Hmcn2 A G 2: 31,391,511 T1913A probably benign Het
Lmo7 T C 14: 101,920,567 probably benign Het
Meioc G A 11: 102,680,031 V863I probably damaging Het
Myh1 A G 11: 67,205,925 I341V probably benign Het
Myh1 A G 11: 67,221,604 D1799G probably damaging Het
Myh13 A G 11: 67,345,002 T664A probably benign Het
Myo3b A C 2: 70,426,849 D1269A probably damaging Het
Nckap1 A G 2: 80,547,899 probably null Het
Nr3c2 A G 8: 76,908,668 probably null Het
Nxpe5 T C 5: 138,239,924 S249P probably damaging Het
Olfr1008 A G 2: 85,690,365 N312S probably benign Het
Olfr460 T C 6: 40,572,205 V273A probably benign Het
Olfr67 C T 7: 103,787,397 M293I probably benign Het
Pitpnm3 G A 11: 72,058,470 T675I probably damaging Het
Plekhm1 C A 11: 103,395,082 E176* probably null Het
Prdm11 C A 2: 92,989,222 probably benign Het
Prodh2 C A 7: 30,506,281 R218S probably damaging Het
Rps15a T C 7: 118,114,837 D54G probably benign Het
Sbno2 G T 10: 80,084,259 T46N possibly damaging Het
Sdk2 A G 11: 113,806,417 probably benign Het
Sema3c T C 5: 17,721,909 F567L probably damaging Het
Slc36a1 A G 11: 55,225,954 probably benign Het
Spaca6 A T 17: 17,838,391 E284V possibly damaging Het
Srsf3 C A 17: 29,036,438 L66I probably damaging Het
Srsf3 T A 17: 29,036,439 L66Q probably damaging Het
Syne1 T C 10: 5,043,652 T8363A possibly damaging Het
Trmt1 T A 8: 84,696,852 L298Q probably damaging Het
Uba6 T C 5: 86,119,401 I923V possibly damaging Het
Uhrf1bp1 A T 17: 27,887,178 T893S probably damaging Het
Vmn2r106 G A 17: 20,267,597 H847Y probably benign Het
Vmn2r15 T C 5: 109,297,535 T8A probably benign Het
Zbtb39 C G 10: 127,742,306 Q250E probably benign Het
Zbtb41 T G 1: 139,439,031 F583V probably damaging Het
Zfp938 T A 10: 82,225,419 I456F probably benign Het
Other mutations in Gckr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Gckr APN 5 31299576 missense probably damaging 1.00
IGL00325:Gckr APN 5 31307767 missense possibly damaging 0.92
IGL00958:Gckr APN 5 31298785 splice site probably null
IGL01102:Gckr APN 5 31309037 missense probably damaging 0.97
IGL01380:Gckr APN 5 31299633 unclassified probably benign
IGL01780:Gckr APN 5 31307790 missense possibly damaging 0.82
IGL02110:Gckr APN 5 31298738 missense possibly damaging 0.94
IGL02187:Gckr APN 5 31307424 splice site probably benign
IGL02350:Gckr APN 5 31307790 missense possibly damaging 0.82
IGL02357:Gckr APN 5 31307790 missense possibly damaging 0.82
IGL02600:Gckr APN 5 31305030 missense probably benign 0.01
IGL02616:Gckr APN 5 31327075 missense probably benign 0.07
IGL02803:Gckr APN 5 31298204 missense probably damaging 1.00
R0004:Gckr UTSW 5 31297589 unclassified probably benign
R0079:Gckr UTSW 5 31306539 missense probably benign 0.01
R0165:Gckr UTSW 5 31326948 missense possibly damaging 0.90
R0853:Gckr UTSW 5 31305048 missense probably damaging 1.00
R2174:Gckr UTSW 5 31327009 missense possibly damaging 0.95
R2212:Gckr UTSW 5 31300867 critical splice donor site probably null
R2892:Gckr UTSW 5 31326472 missense probably benign 0.00
R3412:Gckr UTSW 5 31300867 critical splice donor site probably null
R3413:Gckr UTSW 5 31300867 critical splice donor site probably null
R3764:Gckr UTSW 5 31326498 splice site probably benign
R4608:Gckr UTSW 5 31307797 missense probably damaging 0.99
R4757:Gckr UTSW 5 31307384 missense possibly damaging 0.49
R4814:Gckr UTSW 5 31298300 nonsense probably null
R4953:Gckr UTSW 5 31308264 missense probably damaging 1.00
R5906:Gckr UTSW 5 31306578 missense probably damaging 1.00
R7030:Gckr UTSW 5 31302210 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GCTCTTCGCACAAGAGTTTTCCAAC -3'
(R):5'- CGTGTATTACTGGCACAAGTCCCC -3'

Sequencing Primer
(F):5'- CACAAGAGTTTTCCAACTTCGGTG -3'
(R):5'- CAAGTCCCCTCAGAAGTGGATG -3'
Posted On2013-11-07