Phenotypic Mutation 'Arches' (pdf version)
List |< first << previous [record 21 of 511] next >> last >|
AlleleArches
Mutation Type missense
Chromosome11
Coordinate34,689,760 bp (GRCm38)
Base Change A ⇒ T (forward strand)
Gene Dock2
Gene Name dedicator of cyto-kinesis 2
Synonym(s) CED-5, MBC, Hch
Chromosomal Location 34,226,815-34,783,892 bp (-)
MGI Phenotype Homozygous mutants are defective in the migration of T and B lympohcytes in response to chemokines, and thus display immune defects such as lymphocytopenia, atrophy of lymphoid follicles and loss of marginal-zone B cells.
Accession Number

NCBI RefSeq: NM_033374; MGI:2149010

Mapped Yes 
Amino Acid Change Methionine changed to Lysine
Institutional SourceBeutler Lab
Gene Model predicted sequence gene model
SMART Domains Protein: ENSMUSP00000090884
Gene: ENSMUSG00000020143
AA Change: M661K

DomainStartEndE-ValueType
SH3 11 68 1.22e-11 SMART
Pfam:DOCK_N 71 414 2e-113 PFAM
Pfam:DOCK-C2 419 616 1e-60 PFAM
Pfam:DHR-2 1114 1614 6.3e-96 PFAM
low complexity region 1691 1706 N/A INTRINSIC
low complexity region 1793 1800 N/A INTRINSIC
Predicted Effect possibly damaging

PolyPhen 2 Score 0.467 (Sensitivity: 0.89; Specificity: 0.90)
(Using ENSMUST00000093193)
Phenotypic Category decrease in CD4:CD8, decrease in CD4+ T cells in CD3+ T cells, increase in B1 cells, increase in CD8+ T cells in CD3+ T cells
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles 24 : Chemically induced (ENU) 7, Gene trapped 11, Spontaneous 1, Targeted 5

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Dock2 APN 11 34704661 missense possibly damaging 0.62
IGL00469:Dock2 APN 11 34229603 splice site 0.00
IGL01061:Dock2 APN 11 34705826 missense probably damaging 0.99
IGL01319:Dock2 APN 11 34698790 missense probably benign 0.32
IGL01451:Dock2 APN 11 34310390 missense probably damaging 1.00
IGL01490:Dock2 APN 11 34705781 missense possibly damaging 0.85
IGL01601:Dock2 APN 11 34239528 critical splice donor site probably null 0.00
IGL01800:Dock2 APN 11 34756273 missense possibly damaging 0.95
IGL01804:Dock2 APN 11 34262433 missense probably benign 0.08
IGL01823:Dock2 APN 11 34262391 missense probably damaging 1.00
IGL01829:Dock2 APN 11 34705841 missense possibly damaging 0.94
IGL01830:Dock2 APN 11 34691917 nonsense probably null 0.00
IGL01835:Dock2 APN 11 34310435 missense probably benign 0.31
IGL01845:Dock2 APN 11 34708865 missense probably benign 0.00
IGL01953:Dock2 APN 11 34732356 missense probably benign 0.00
IGL01989:Dock2 APN 11 34268053 missense probably benign 0.00
IGL02081:Dock2 APN 11 34254355 missense probably benign 0.00
IGL02105:Dock2 APN 11 34714525 missense probably damaging 1.00
IGL02153:Dock2 APN 11 34230670 missense probably benign 0.00
IGL02170:Dock2 APN 11 34267949 missense probably damaging 1.00
IGL02344:Dock2 APN 11 34731510 missense possibly damaging 0.65
IGL02389:Dock2 APN 11 34698740 splice site 0.00
IGL02409:Dock2 APN 11 34501204 missense probably benign 0.00
IGL02472:Dock2 APN 11 34249801 missense probably benign 0.00
IGL02625:Dock2 APN 11 34501168 splice site 0.00
IGL02929:Dock2 APN 11 34268048 missense probably damaging 0.99
IGL02951:Dock2 APN 11 34310448 splice site 0.00
IGL02999:Dock2 APN 11 34692259 missense probably damaging 1.00
IGL03165:Dock2 APN 11 34687533 missense possibly damaging 0.93
capitol_reef UTSW 11 34294170 critical splice acceptor site probably null
denali UTSW 11 34229472 critical splice donor site probably null
dew UTSW 11 34248636 nonsense
frazz UTSW 11 34248572 critical splice donor site
frizz UTSW 11 34258184 splice acceptor site
liaoning UTSW 11 34708793 missense probably damaging 1.00
IGL03052:Dock2 UTSW 11 34232853 missense probably benign 0.01
R0006:Dock2 UTSW 11 34312453 splice donor site probably benign
R0012:Dock2 UTSW 11 34783795 missense probably benign 0.29
R0063:Dock2 UTSW 11 34756284 critical splice acceptor site probably null
R0063:Dock2 UTSW 11 34756284 critical splice acceptor site probably null
R0116:Dock2 UTSW 11 34688565 splice acceptor site probably benign
R0149:Dock2 UTSW 11 34438327 missense probably damaging 1.00
R0361:Dock2 UTSW 11 34438327 missense probably damaging 1.00
R0462:Dock2 UTSW 11 34268052 missense possibly damaging 0.56
R0471:Dock2 UTSW 11 34688553 missense probably benign 0.01
R0538:Dock2 UTSW 11 34704718 splice acceptor site probably benign
R0543:Dock2 UTSW 11 34294325 missense probably damaging 1.00
R0660:Dock2 UTSW 11 34248621 missense probably damaging 1.00
R0676:Dock2 UTSW 11 34695236 missense probably benign 0.39
R0722:Dock2 UTSW 11 34464970 splice acceptor site probably benign
R0801:Dock2 UTSW 11 34708793 missense probably damaging 1.00
R1110:Dock2 UTSW 11 34256535 missense possibly damaging 0.63
R1121:Dock2 UTSW 11 34756291 splice acceptor site probably benign
R1171:Dock2 UTSW 11 34695241 missense possibly damaging 0.93
R1387:Dock2 UTSW 11 34273309 splice acceptor site probably benign
R1435:Dock2 UTSW 11 34718836 splice donor site probably benign
R1445:Dock2 UTSW 11 34239705 missense probably benign 0.00
R1494:Dock2 UTSW 11 34282761 nonsense probably null
R1589:Dock2 UTSW 11 34706461 missense possibly damaging 0.63
R1597:Dock2 UTSW 11 34704647 missense probably benign 0.00
R1616:Dock2 UTSW 11 34363848 splice donor site probably benign
R1629:Dock2 UTSW 11 34262480 splice acceptor site probably null
R1749:Dock2 UTSW 11 34232767 critical splice donor site probably null
R1888:Dock2 UTSW 11 34707342 missense probably damaging 1.00
R1888:Dock2 UTSW 11 34707342 missense probably damaging 1.00
R1899:Dock2 UTSW 11 34294286 missense probably benign 0.00
R1924:Dock2 UTSW 11 34464934 missense probably benign 0.02
R2031:Dock2 UTSW 11 34727470 splice acceptor site probably benign
R2045:Dock2 UTSW 11 34294106 splice donor site probably benign
R2098:Dock2 UTSW 11 34266279 missense probably benign 0.08
R2098:Dock2 UTSW 11 34719005 missense possibly damaging 0.83
R2129:Dock2 UTSW 11 34727415 missense probably benign 0.27
R2147:Dock2 UTSW 11 34229472 critical splice donor site probably null
R2149:Dock2 UTSW 11 34229472 critical splice donor site probably null
R2150:Dock2 UTSW 11 34229472 critical splice donor site probably null
R2176:Dock2 UTSW 11 34695217 missense probably benign 0.00
R2185:Dock2 UTSW 11 34227740 splice acceptor site probably benign
R2230:Dock2 UTSW 11 34294323 missense possibly damaging 0.89
R2441:Dock2 UTSW 11 34262380 splice donor site probably benign
R2508:Dock2 UTSW 11 34312485 missense probably benign 0.03
R2875:Dock2 UTSW 11 34718885 missense probably damaging 1.00
R2885:Dock2 UTSW 11 34689766 missense probably damaging 1.00
R2910:Dock2 UTSW 11 34232910 splice acceptor site probably benign
R2911:Dock2 UTSW 11 34232910 splice acceptor site probably benign
R3081:Dock2 UTSW 11 34231610 missense probably benign 0.00
R3418:Dock2 UTSW 11 34689760 missense possibly damaging 0.47
R3552:Dock2 UTSW 11 34720960 missense probably benign 0.22
R3731:Dock2 UTSW 11 34708895 missense probably damaging 1.00
R3846:Dock2 UTSW 11 34732371 missense possibly damaging 0.81
R4135:Dock2 UTSW 11 34714501 missense possibly damaging 0.83
R4598:Dock2 UTSW 11 34239536 missense probably damaging 1.00
R4599:Dock2 UTSW 11 34239536 missense probably damaging 1.00
R4715:Dock2 UTSW 11 34294118 missense probably damaging 1.00
R4722:Dock2 UTSW 11 34695471 missense probably damaging 1.00
R4742:Dock2 UTSW 11 34294170 unclassified probably null
R4830:Dock2 UTSW 11 34273767 splice site probably null
R4884:Dock2 UTSW 11 34266248 missense probably damaging 1.00
R4990:Dock2 UTSW 11 34695251 missense probably damaging 1.00
R5334:Dock2 UTSW 11 34228643 missense probably benign 0.00
R5570:Dock2 UTSW 11 34727406 missense probably damaging 1.00
R5602:Dock2 UTSW 11 34254391 missense probably benign 0.16
R5809:Dock2 UTSW 11 34262445 missense probably benign
R5860:Dock2 UTSW 11 34256562 missense probably damaging 1.00
X0017:Dock2 UTSW 11 34266271 missense probably benign 0.04
X0018:Dock2 UTSW 11 34232833 missense possibly damaging 0.65
X0022:Dock2 UTSW 11 34261564 splice acceptor site probably benign
X0058:Dock2 UTSW 11 34256564 missense probably damaging 1.00
X0066:Dock2 UTSW 11 34310357 missense possibly damaging 0.95
Z1088:Dock2 UTSW 11 34438300 missense probably benign 0.14
Z1088:Dock2 UTSW 11 34692382 missense probably damaging 1.00
Z1088:Dock2 UTSW 11 34695212 nonsense probably null
Mode of Inheritance Autosomal Semidominant
Local Stock
MMRRC Submission
Last Updated 12/08/2016 10:06 AM by Katherine Timer
Record Created 11/05/2015 1:18 PM
Record Posted 11/09/2015
Phenotypic Description

Figure 1. Arches mice exhibit increased frequencies of peripheral B1 cells. Flow cytometric analysis of peripheral blood was utilized to determine B1 cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Arches mice exhibit a reduced peripheral blood CD4:CD8 T cell ratio. Flow cytometric analysis of peripheral blood was utilized to determine CD4+ and CD8+ T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 3. Arches mice exhibit reduced frequencies of peripheral CD4+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD4+ T cells in CD3+ T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. Arches mice exhibit increased frequencies of peripheral CD8+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD8+ T cells in CD3+ T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Arches phenotype was identified among G3 mice of the pedigree R3418, some of which showed an increased frequency of B1 cells (Figure 1) as well as a decrease in the CD4+ to CD8+ T cell ratio (Figure 2) caused by a diminished frequency of CD4+ T cells in CD3+ T cells (Figure 3) coupled with an increased frequency of CD8+ T cells in CD3+ T cells (Figure 4), all in the peripheral blood.

Nature of Mutation

Figure 5. Linkage mapping of the normalized reduced CD4+ to CD8+ T cell ratio using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 63 mutations (X-axis) identified in the G1 male of pedigree R3418. Normalized phenotype data are shown for single locus linkage analysis with consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 63 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Dock2:  a T to A transversion at base pair 34,689,760 (v38) on chromosome 11, or base pair 94,146 in the GenBank genomic region NC_000077 for the Dock2 gene.  The strongest association was found with an additive model of linkage to the normalized CD4+ to CD8+ T cell ratio, wherein four variant homozygotes and 18 heterozygotes departed phenotypically from 15 homozygous reference mice with a P value of 4.808 x 10-6 (Figure 5).  A recessive effect (P = 9.733 x 10-6) was observed in the B1 cell assay, but the mutation is preponderantly semidominant. 

 

The mutation corresponds to residue 2,064 in the mRNA sequence NM_033374 within exon 20 of 52 total exons.


 
2048 CTCTTCAACATCATGATGGAACACTCTCAGAGT

656  -L--F--N--I--M--M--E--H--S--Q--S-

 

The mutated nucleotide is indicated in red.  The mutation results in a methionine (M) to lysine (K) substitution at position 661 (M661K) in the DOCK2 protein, and is predicted by PolyPhen-2 to be possibly damaging (score = 0.467) (1).

 

Protein Prediction

Figure 6. Domain structure of mouse DOCK2. DOCK2 contains an N-terminal SH3 domain. SH3-containing DOCK proteins have been shown to interact physically with the scaffolding proteins engulfment and cell motility protein 1 (ELMO1) and ELMO2, significantly promoting Rac activation. The DHR-1 domain shares weak homology to the C2 domain. The large DHR-2 domain interacts with the nucleotide-free form of Rac. The Arches mutation results in a methionine (M) to lysine (K) substitution at position 661 (M661K). Click on the image to view other mutations found in DOCK2. Click on each mututation for more specific information.

DOCK2 belongs to the DOCK180 superfamily of guanine nucleotide exchange factors (GEFs) that have been shown to activate members of the Rho family of small GTPases [Figure 6; (2-5)]. Members of the DOCK A and B groups contain an N-terminal SH3 domain. Two domains are shared amongst all DOCK proteins, the catalytic DHR-2 (DOCK homology region 2) or CZH-2 (CDM-zizimin homology 2) domain (amino acids 1114-1620 in DOCK2) and the DHR-1 or CZH-1 domain (amino acids 420-662 in DOCK2) (3;5).  Several DOCK proteins, including DOCK2, appear to be localized to the plasma membrane via interaction of the DHR-1 domain with phosphatidylinositol (3,5)-biphosphate [PtdIns(3,5)P2] and phosphatidylinositol (3,4,5) P3 (PIP3) signaling lipids (6;7). The DHR-2 domains of several DOCK family members interact with the nucleotide-free form of Rac and/or Cdc42 (3;5). DOCK2 has an N-terminal SH3 domain (amino acids 8-69). The Arches mutation results in a methionine (M) to lysine (K) substitution at position 661 within the DHR-1 domain.

 

For more information on Dock2, see the record for frazz.

Putative Mechanism

Rho GTPases are known regulators of the actin cytoskeleton and affect multiple cellular activities including cell morphology, polarity, migration, proliferation and apoptosis, phagocytosis, cytokinesis, adhesion, vesicular transport, transcription and neurite extension and retraction. Regulation of Rho GTPase activity involves the GEFs that promote the exchange of GDP for GTP, the GTPase-activating proteins (GAPs) that enhance the GTPase activity of Rho proteins, and the Rho guanine nucleotide-dissociation inhibitors (RhoGDIs) that sequester Rho GTPases in a GDP-bound state. DOCK2 functions in the polarization and migration of immune cell subsets.  DOCK2 functions downstream of chemokine receptors to regulate Rac activation and migration of B and T lymphocytes, neutrophils, plasmacytoid dendritic cells (pDCs), and hematopoietic stem cells, but not monocytes or other myeloid cell types (7-11).  The immune cells affected by DOCK2 deficiency display aberrant homing, activation, adhesion, polarization and migration. DOCK2-deficient lymphocytes fail to respond normally to the chemokines CCL21, CCL19, CXCL13, and CXCL12, resulting in impaired homing to secondary lymphoid organs and aberrant morphology of these tissues (9)Dock2 -/ -mice display a number of immunological phenotypes including lack of marginal zone B cells, reduced numbers of mature CD4+ T cells and the major subset of natural killer T (NKT) cells expressing the semi-invariant Vα14 T cell receptor (TCR), and aberrant TCR signaling (9;12;13).  Similar to Dock2-/ - mice, the Arches mice exhibit reduced frequencies of peripheral CD4+ T cells, indicating loss of function in DOCK2Arches.

Primers PCR Primer
Arches(F):5'- AGGTCACCTGCCAAGTCTTG -3'
Arches(R):5'- TGTAGCTGATTCGTGAGACTTCTC -3'

Sequencing Primer
Arches_seq(F):5'- GAAACAGCTACTCAGTCTGCTTG -3'
Arches_seq(R):5'- AGACTTCTCTGAGCGCCTTGAAC -3'
References
Science Writers Anne Murray
Illustrators Katherine Timer
AuthorsMing Zeng, Xue Zhong, and Bruce Beutler
List |< first << previous [record 21 of 511] next >> last >|