Incidental Mutation 'R0149:Dock2'
ID22738
Institutional Source Beutler Lab
Gene Symbol Dock2
Ensembl Gene ENSMUSG00000020143
Gene Namededicator of cyto-kinesis 2
SynonymsCED-5, MBC, Hch
MMRRC Submission 038433-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0149 (G1)
Quality Score225
Status Validated (trace)
Chromosome11
Chromosomal Location34226815-34783892 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34438327 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 202 (L202P)
Ref Sequence ENSEMBL: ENSMUSP00000098915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093193] [ENSMUST00000101364] [ENSMUST00000101365] [ENSMUST00000143540]
Predicted Effect probably damaging
Transcript: ENSMUST00000093193
AA Change: L915P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090884
Gene: ENSMUSG00000020143
AA Change: L915P

DomainStartEndE-ValueType
SH3 11 68 1.22e-11 SMART
Pfam:DOCK_N 71 414 2e-113 PFAM
Pfam:DOCK-C2 419 616 1e-60 PFAM
Pfam:DHR-2 1114 1614 6.3e-96 PFAM
low complexity region 1691 1706 N/A INTRINSIC
low complexity region 1793 1800 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101364
AA Change: L202P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000101365
AA Change: L915P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000098916
Gene: ENSMUSG00000020143
AA Change: L915P

DomainStartEndE-ValueType
SH3 11 68 1.22e-11 SMART
Pfam:DOCK_N 71 414 1.4e-113 PFAM
Pfam:DOCK-C2 419 616 5.5e-61 PFAM
low complexity region 1163 1171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143540
SMART Domains Protein: ENSMUSP00000116893
Gene: ENSMUSG00000020143

DomainStartEndE-ValueType
SH3 11 68 1.22e-11 SMART
Pfam:DOCK-C2 418 617 1.8e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154178
Meta Mutation Damage Score 0.28 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 97% (84/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the CDM protein family. It is specifically expressed in hematopoietic cells and is predominantly expressed in peripheral blood leukocytes. The protein is involved in remodeling of the actin cytoskeleton required for lymphocyte migration in response to chemokine signaling. It activates members of the Rho family of GTPases, for example RAC1 and RAC2, by acting as a guanine nucleotide exchange factor (GEF) to exchange bound GDP for free GTP. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygous mutants are defective in the migration of T and B lympohcytes in response to chemokines, and thus display immune defects such as lymphocytopenia, atrophy of lymphoid follicles and loss of marginal-zone B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230072I06Rik A C 8: 12,280,000 S152R unknown Het
Acsbg2 A G 17: 56,853,924 probably benign Het
Adam6a G T 12: 113,545,749 V581F probably damaging Het
Adgrl3 A T 5: 81,760,697 I1165F probably damaging Het
Aldh1l1 A G 6: 90,589,414 K656E possibly damaging Het
Ankhd1 T C 18: 36,647,214 I1773T probably damaging Het
Api5 A T 2: 94,423,497 L287* probably null Het
Ascc3 A T 10: 50,607,993 N55I probably benign Het
Cav1 C A 6: 17,339,353 R146S possibly damaging Het
Cdhr2 A T 13: 54,734,007 I1118F probably damaging Het
Cemip A G 7: 83,964,010 I660T probably benign Het
Clk1 T A 1: 58,414,601 N305Y probably damaging Het
Cux1 T A 5: 136,279,497 I1263F probably damaging Het
Cyp2d26 A G 15: 82,792,767 L152P probably damaging Het
Dmtf1 A G 5: 9,132,571 S188P probably damaging Het
Dscaml1 T G 9: 45,742,680 Y1418* probably null Het
Efemp2 A T 19: 5,477,960 H107L probably damaging Het
Eng T C 2: 32,672,385 probably null Het
Erc1 A T 6: 119,824,830 S75R probably damaging Het
Fgl2 A T 5: 21,375,785 D375V probably damaging Het
Fpr-rs6 T C 17: 20,182,213 I295M probably benign Het
Fsip2 T C 2: 82,975,505 S723P possibly damaging Het
Gdpd5 A G 7: 99,458,790 I530V possibly damaging Het
Gm15217 T A 14: 46,380,384 probably benign Het
Gm4922 T C 10: 18,783,541 T478A probably benign Het
Gm6614 T C 6: 141,992,477 T239A probably benign Het
Gmcl1 A T 6: 86,732,909 probably null Het
Has1 T C 17: 17,850,171 T163A probably damaging Het
Hmcn1 A T 1: 150,677,324 N2538K probably benign Het
Itga2 A G 13: 114,836,579 probably benign Het
Kcnip1 A T 11: 33,843,177 M5K probably benign Het
Kcnk4 T C 19: 6,926,194 E329G probably benign Het
Kcnt1 T C 2: 25,898,264 probably benign Het
Klkb1 A G 8: 45,276,063 C375R probably damaging Het
Loxl2 C A 14: 69,693,078 H764N probably benign Het
Lrrc55 A T 2: 85,196,245 M145K probably damaging Het
Lrrtm2 A G 18: 35,212,932 I439T probably benign Het
Magi1 A T 6: 93,747,245 I263N probably damaging Het
Map4 C T 9: 110,067,624 P641L probably damaging Het
Mars A T 10: 127,300,034 N558K probably damaging Het
Mfap2 A G 4: 141,014,983 D98G probably damaging Het
Mgat5b A G 11: 116,985,139 probably benign Het
Mki67 A T 7: 135,698,424 V1627D probably benign Het
Mtnr1a A T 8: 45,069,315 I36F probably benign Het
Myh15 A T 16: 49,114,005 N645I probably benign Het
Myo7b T A 18: 32,014,209 I94F probably damaging Het
Nefh A T 11: 4,940,799 S607T probably benign Het
Ngf T A 3: 102,520,446 H174Q probably benign Het
Noa1 G A 5: 77,297,173 Q600* probably null Het
Nr2f2 A G 7: 70,358,062 V71A possibly damaging Het
Oas2 A T 5: 120,738,401 F492L probably damaging Het
Olfr1390 A T 11: 49,340,814 Y94F probably benign Het
Olfr935 T A 9: 38,994,584 M284L probably benign Het
Osmr A G 15: 6,841,951 probably null Het
P4ha1 A G 10: 59,348,399 T228A probably damaging Het
Pip5kl1 T C 2: 32,578,954 V195A possibly damaging Het
Plagl2 A T 2: 153,231,603 D459E probably benign Het
Plxna1 T C 6: 89,320,613 E1863G probably null Het
Prdm10 T G 9: 31,316,159 probably benign Het
Prr14l A C 5: 32,793,641 L1936R probably damaging Het
Rgs1 T C 1: 144,249,087 probably benign Het
Rgsl1 A G 1: 153,793,764 F292S probably damaging Het
Rhobtb2 T C 14: 69,795,908 T538A probably benign Het
Rictor A G 15: 6,784,107 N1025D possibly damaging Het
Rsph10b T A 5: 143,938,909 probably benign Het
Rwdd4a A G 8: 47,544,220 D158G probably null Het
Sdk1 T C 5: 141,857,054 probably benign Het
Serpina3n A C 12: 104,411,376 K296T probably benign Het
Snw1 A G 12: 87,461,917 V124A possibly damaging Het
Tas2r137 T G 6: 40,491,298 F21V probably benign Het
Tmc6 G A 11: 117,769,448 L655F probably damaging Het
Tmem260 A T 14: 48,452,047 T108S possibly damaging Het
Trim2 T C 3: 84,190,776 Y406C probably damaging Het
Tsc1 T C 2: 28,670,901 I257T probably damaging Het
Ttn T C 2: 76,843,402 probably benign Het
Unc80 T A 1: 66,521,601 N829K possibly damaging Het
Vmn1r235 A C 17: 21,261,995 D194A probably damaging Het
Vmn2r100 A T 17: 19,521,247 probably null Het
Ylpm1 G T 12: 85,028,838 R321L probably damaging Het
Zan T C 5: 137,396,766 T4381A unknown Het
Zfp457 A G 13: 67,292,646 F622L probably damaging Het
Zfy1 T C Y: 726,121 H548R possibly damaging Het
Zmym4 A T 4: 126,911,145 S441T probably benign Het
Other mutations in Dock2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Dock2 APN 11 34704661 missense probably damaging 1.00
IGL00469:Dock2 APN 11 34229603 splice site probably benign
IGL01061:Dock2 APN 11 34705826 missense probably damaging 1.00
IGL01319:Dock2 APN 11 34698790 missense possibly damaging 0.61
IGL01451:Dock2 APN 11 34310390 missense probably damaging 1.00
IGL01490:Dock2 APN 11 34705781 missense probably damaging 0.97
IGL01601:Dock2 APN 11 34239528 critical splice donor site probably null
IGL01800:Dock2 APN 11 34756273 missense probably damaging 1.00
IGL01804:Dock2 APN 11 34262433 missense probably benign 0.01
IGL01823:Dock2 APN 11 34262391 missense probably damaging 1.00
IGL01829:Dock2 APN 11 34705841 missense probably damaging 0.98
IGL01830:Dock2 APN 11 34691917 nonsense probably null
IGL01835:Dock2 APN 11 34310435 missense possibly damaging 0.51
IGL01845:Dock2 APN 11 34708865 missense probably benign 0.02
IGL01953:Dock2 APN 11 34732356 missense probably benign 0.28
IGL01989:Dock2 APN 11 34268053 missense probably benign
IGL02081:Dock2 APN 11 34254355 missense probably benign
IGL02105:Dock2 APN 11 34714525 missense probably damaging 1.00
IGL02153:Dock2 APN 11 34230670 missense probably benign 0.01
IGL02170:Dock2 APN 11 34267949 missense probably damaging 1.00
IGL02344:Dock2 APN 11 34731510 missense probably damaging 0.98
IGL02389:Dock2 APN 11 34698740 splice site probably benign
IGL02409:Dock2 APN 11 34501204 missense probably benign 0.00
IGL02472:Dock2 APN 11 34249801 missense probably benign 0.00
IGL02625:Dock2 APN 11 34501168 critical splice donor site probably null
IGL02929:Dock2 APN 11 34268048 missense probably damaging 1.00
IGL02951:Dock2 APN 11 34310448 unclassified probably benign
IGL02999:Dock2 APN 11 34692259 missense probably damaging 0.99
IGL03165:Dock2 APN 11 34687533 missense probably damaging 0.99
Arches UTSW 11 34689760 missense probably damaging 1.00
capitol_reef UTSW 11 34294170 critical splice acceptor site probably null
denali UTSW 11 34229472 critical splice donor site probably null
dew UTSW 11 34248636 nonsense probably null
Dry UTSW 11 34231652 missense possibly damaging 0.79
frazz UTSW 11 34248572 critical splice donor site probably benign
frizz UTSW 11 34258184 splice site probably benign
Harborside UTSW 11 34262445 missense probably benign
Landing UTSW 11 34714501 missense possibly damaging 0.83
Launch UTSW 11 34256562 missense probably damaging 1.00
liaoning UTSW 11 34708793 missense probably damaging 1.00
muelle UTSW 11 34687538 missense probably damaging 1.00
pier UTSW 11 34689766 missense probably damaging 1.00
plank UTSW 11 34783795 missense possibly damaging 0.51
riches UTSW 11 34688452 critical splice donor site probably null
skiff UTSW 11 34262388 missense probably null 0.80
Slip UTSW 11 34294286 missense probably benign 0.25
wassup UTSW 11 34503413 missense probably damaging 1.00
Wharf UTSW 11 34732371 missense possibly damaging 0.81
IGL03052:Dock2 UTSW 11 34232853 missense probably benign 0.01
PIT4377001:Dock2 UTSW 11 34721008 missense probably benign 0.02
R0006:Dock2 UTSW 11 34312453 unclassified probably benign
R0012:Dock2 UTSW 11 34783795 missense possibly damaging 0.51
R0063:Dock2 UTSW 11 34756284 critical splice acceptor site probably null
R0063:Dock2 UTSW 11 34756284 critical splice acceptor site probably null
R0116:Dock2 UTSW 11 34688565 intron probably benign
R0361:Dock2 UTSW 11 34438327 missense probably damaging 1.00
R0462:Dock2 UTSW 11 34268052 missense possibly damaging 0.74
R0471:Dock2 UTSW 11 34688553 missense probably benign 0.30
R0538:Dock2 UTSW 11 34704718 splice site probably benign
R0543:Dock2 UTSW 11 34294325 missense probably damaging 1.00
R0660:Dock2 UTSW 11 34248621 missense probably damaging 1.00
R0676:Dock2 UTSW 11 34695236 missense probably damaging 0.99
R0722:Dock2 UTSW 11 34464970 splice site probably benign
R0801:Dock2 UTSW 11 34708793 missense probably damaging 1.00
R1110:Dock2 UTSW 11 34256535 missense possibly damaging 0.78
R1171:Dock2 UTSW 11 34695241 missense probably damaging 1.00
R1387:Dock2 UTSW 11 34273309 splice site probably benign
R1445:Dock2 UTSW 11 34239705 missense probably benign
R1494:Dock2 UTSW 11 34282761 nonsense probably null
R1589:Dock2 UTSW 11 34706461 missense probably damaging 0.99
R1597:Dock2 UTSW 11 34704647 missense probably benign 0.00
R1629:Dock2 UTSW 11 34262480 splice site probably null
R1749:Dock2 UTSW 11 34232767 critical splice donor site probably null
R1888:Dock2 UTSW 11 34707342 missense probably damaging 1.00
R1888:Dock2 UTSW 11 34707342 missense probably damaging 1.00
R1899:Dock2 UTSW 11 34294286 missense probably benign 0.25
R1924:Dock2 UTSW 11 34464934 missense possibly damaging 0.69
R2031:Dock2 UTSW 11 34727470 splice site probably benign
R2045:Dock2 UTSW 11 34294106 splice site probably null
R2098:Dock2 UTSW 11 34266279 missense probably benign 0.16
R2098:Dock2 UTSW 11 34719005 missense probably damaging 0.99
R2129:Dock2 UTSW 11 34727415 missense probably damaging 1.00
R2147:Dock2 UTSW 11 34229472 critical splice donor site probably null
R2149:Dock2 UTSW 11 34229472 critical splice donor site probably null
R2150:Dock2 UTSW 11 34229472 critical splice donor site probably null
R2176:Dock2 UTSW 11 34695217 missense probably benign 0.00
R2230:Dock2 UTSW 11 34294323 missense probably damaging 0.99
R2508:Dock2 UTSW 11 34312485 missense probably benign 0.04
R2875:Dock2 UTSW 11 34718885 missense probably damaging 1.00
R2885:Dock2 UTSW 11 34689766 missense probably damaging 1.00
R2910:Dock2 UTSW 11 34232910 splice site probably benign
R3081:Dock2 UTSW 11 34231610 missense probably benign
R3418:Dock2 UTSW 11 34689760 missense probably damaging 1.00
R3552:Dock2 UTSW 11 34720960 missense probably benign 0.22
R3731:Dock2 UTSW 11 34708895 missense probably damaging 1.00
R3846:Dock2 UTSW 11 34732371 missense possibly damaging 0.81
R4135:Dock2 UTSW 11 34714501 missense possibly damaging 0.83
R4598:Dock2 UTSW 11 34239536 missense probably damaging 1.00
R4599:Dock2 UTSW 11 34239536 missense probably damaging 1.00
R4715:Dock2 UTSW 11 34294118 missense probably damaging 1.00
R4722:Dock2 UTSW 11 34695471 missense probably damaging 1.00
R4742:Dock2 UTSW 11 34294170 critical splice acceptor site probably null
R4830:Dock2 UTSW 11 34273767 splice site probably null
R4884:Dock2 UTSW 11 34266248 missense probably damaging 1.00
R4990:Dock2 UTSW 11 34695251 missense probably damaging 1.00
R5334:Dock2 UTSW 11 34228643 missense probably benign 0.00
R5570:Dock2 UTSW 11 34727406 missense probably damaging 1.00
R5602:Dock2 UTSW 11 34254391 missense probably benign 0.16
R5681:Dock2 UTSW 11 34249836 missense probably benign 0.06
R5809:Dock2 UTSW 11 34262445 missense probably benign
R5860:Dock2 UTSW 11 34256562 missense probably damaging 1.00
R6111:Dock2 UTSW 11 34708787 missense probably damaging 0.99
R6155:Dock2 UTSW 11 34294123 missense probably benign 0.06
R6156:Dock2 UTSW 11 34247789 missense possibly damaging 0.51
R6173:Dock2 UTSW 11 34262388 missense probably null 0.80
R6182:Dock2 UTSW 11 34229476 missense probably damaging 0.97
R6188:Dock2 UTSW 11 34503396 missense probably damaging 0.98
R6191:Dock2 UTSW 11 34231652 missense possibly damaging 0.79
R6283:Dock2 UTSW 11 34707325 missense probably damaging 0.99
R6395:Dock2 UTSW 11 34232874 missense probably damaging 1.00
R6465:Dock2 UTSW 11 34503413 missense probably damaging 1.00
R6500:Dock2 UTSW 11 34362822 missense possibly damaging 0.76
R6561:Dock2 UTSW 11 34687538 missense probably damaging 1.00
R6745:Dock2 UTSW 11 34705842 missense probably damaging 1.00
R6745:Dock2 UTSW 11 34705843 missense probably damaging 1.00
R6880:Dock2 UTSW 11 34688452 critical splice donor site probably null
R6913:Dock2 UTSW 11 34756222 missense probably damaging 1.00
R6997:Dock2 UTSW 11 34464922 missense probably damaging 1.00
R7057:Dock2 UTSW 11 34227684 missense probably benign 0.10
R7057:Dock2 UTSW 11 34695217 missense probably benign 0.00
R7134:Dock2 UTSW 11 34310363 missense probably benign 0.03
X0017:Dock2 UTSW 11 34266271 missense probably benign 0.08
X0018:Dock2 UTSW 11 34232833 missense possibly damaging 0.65
X0058:Dock2 UTSW 11 34256564 missense probably damaging 1.00
X0066:Dock2 UTSW 11 34310357 missense possibly damaging 0.95
Z1088:Dock2 UTSW 11 34438300 missense probably benign 0.14
Z1088:Dock2 UTSW 11 34692382 missense probably damaging 1.00
Z1088:Dock2 UTSW 11 34695212 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGCAGAGTTCACACCATCAAGTCAC -3'
(R):5'- ACCCTTGAGCCTTGGGAAGACATAG -3'

Sequencing Primer
(F):5'- AGTGACATACCACTCCTGCTG -3'
(R):5'- TCCAGAGAAAGACTGATGTCTGTC -3'
Posted On2013-04-16