Incidental Mutation 'R1274:Olfr1163'
ID150833
Institutional Source Beutler Lab
Gene Symbol Olfr1163
Ensembl Gene ENSMUSG00000075137
Gene Nameolfactory receptor 1163
SynonymsMOR174-8, GA_x6K02T2Q125-49563265-49562315
MMRRC Submission 039340-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R1274 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location88069817-88071830 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 88070595 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tryptophan at position 262 (C262W)
Ref Sequence ENSEMBL: ENSMUSP00000149399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099835] [ENSMUST00000215268]
Predicted Effect probably damaging
Transcript: ENSMUST00000099835
AA Change: C262W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097423
Gene: ENSMUSG00000075137
AA Change: C262W

DomainStartEndE-ValueType
Pfam:7tm_4 33 310 1.2e-44 PFAM
Pfam:7tm_1 43 292 2.3e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215268
AA Change: C262W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1l2 T C 19: 56,914,563 D728G probably benign Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Ceacam3 A G 7: 17,163,139 R677G probably damaging Het
Col16a1 T A 4: 130,097,801 M1431K probably damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Gm11487 T C 4: 73,403,076 Y148C probably damaging Het
Gm6563 A T 19: 23,676,337 I164F probably benign Het
Nav2 C A 7: 49,604,430 Y2325* probably null Het
Olfr1335 T C 4: 118,809,396 N156S probably benign Het
P2ry12 T C 3: 59,217,220 T345A possibly damaging Het
Ptpn13 C T 5: 103,550,260 P1078S probably damaging Het
Rgs20 G A 1: 4,912,447 T166I probably damaging Het
Sik1 A T 17: 31,846,575 L683Q possibly damaging Het
Slc7a5 C T 8: 121,883,714 V454M probably benign Het
Snx30 A G 4: 59,885,133 T258A probably benign Het
Vmn1r234 CTT CTTT 17: 21,229,251 probably null Het
Zfp335 GTCCTCCTCCTCCTCCTC GTCCTCCTCCTCCTC 2: 164,907,468 probably benign Het
Other mutations in Olfr1163
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01447:Olfr1163 APN 2 88071124 missense possibly damaging 0.56
IGL01472:Olfr1163 APN 2 88070978 missense possibly damaging 0.56
IGL02111:Olfr1163 APN 2 88071227 missense probably benign 0.22
R1938:Olfr1163 UTSW 2 88070956 missense probably damaging 1.00
R2012:Olfr1163 UTSW 2 88070719 missense probably benign 0.03
R3056:Olfr1163 UTSW 2 88071239 missense probably benign
R4127:Olfr1163 UTSW 2 88071235 missense probably benign 0.00
R4748:Olfr1163 UTSW 2 88070612 missense probably benign 0.44
R4749:Olfr1163 UTSW 2 88070612 missense probably benign 0.44
R4769:Olfr1163 UTSW 2 88070729 missense probably benign 0.25
R6647:Olfr1163 UTSW 2 88070709 missense probably benign 0.03
R7111:Olfr1163 UTSW 2 88070656 missense probably damaging 1.00
R7168:Olfr1163 UTSW 2 88070577 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- CATGGTAGAGAGAAACAGCCAGTGTTC -3'
(R):5'- CAAGCTGCTTGAAAACTTGGTCCTG -3'

Sequencing Primer
(F):5'- GATGGCTCAGTGAAGTTGGA -3'
(R):5'- ACTGGGTCATATATCTGGAGTACC -3'
Posted On2014-01-29