Incidental Mutation 'R1238:Pwp1'
ID152504
Institutional Source Beutler Lab
Gene Symbol Pwp1
Ensembl Gene ENSMUSG00000001785
Gene NamePWP1 homolog, endonuclein
Synonyms2610205J09Rik, 2310058A11Rik
MMRRC Submission 039305-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1238 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location85829494-85889096 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85885862 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 411 (I411V)
Ref Sequence ENSEMBL: ENSMUSP00000001836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001836] [ENSMUST00000219256]
Predicted Effect probably benign
Transcript: ENSMUST00000001836
AA Change: I411V

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000001836
Gene: ENSMUSG00000001785
AA Change: I411V

DomainStartEndE-ValueType
low complexity region 45 61 N/A INTRINSIC
Blast:WD40 168 220 4e-27 BLAST
WD40 244 284 4.51e-7 SMART
WD40 287 327 3.37e-6 SMART
WD40 331 370 4.42e1 SMART
WD40 373 413 6.38e-7 SMART
Blast:WD40 418 458 3e-23 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164053
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164562
Predicted Effect probably benign
Transcript: ENSMUST00000219256
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219626
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219902
Meta Mutation Damage Score 0.0969 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.2%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains several WD-40 repeats and is found mostly in the nucleus. The expression and localization of this protein are cell cycle dependent. Expression of this gene is upregulated in pancreatic adenocarcinoma. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 G A 14: 118,597,639 probably benign Het
BC051665 T A 13: 60,784,637 N78I probably damaging Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Cep290 A C 10: 100,517,863 Q819H probably damaging Het
Cep70 T C 9: 99,254,265 I7T probably benign Het
Chd1l C T 3: 97,582,731 E503K probably benign Het
Cit T A 5: 115,851,221 F56I probably benign Het
Colec10 T C 15: 54,462,439 F222L possibly damaging Het
Crocc G A 4: 141,035,364 A769V probably benign Het
Ctcf T C 8: 105,671,277 probably benign Het
Ect2l T C 10: 18,143,104 R607G possibly damaging Het
Efcab6 T G 15: 83,933,137 E745A probably benign Het
Eif1ad T G 19: 5,370,083 *171G probably null Het
Gm4759 A G 7: 106,423,057 V246A probably damaging Het
H2-D1 A G 17: 35,263,932 D146G probably damaging Het
Iqub C T 6: 24,505,885 R8H probably benign Het
Itih4 A T 14: 30,887,949 I79F probably damaging Het
Kdm5d G A Y: 941,282 R1161H probably damaging Het
Map4 T C 9: 110,068,580 S675P probably benign Het
Mfsd4b3 A T 10: 39,947,226 V346E probably damaging Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Olfr50 A T 2: 36,793,589 M118L probably damaging Het
Olfr867 T A 9: 20,055,461 M1L probably benign Het
P2rx1 A C 11: 73,012,958 K282T probably damaging Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Ptprj A T 2: 90,444,414 probably null Het
Rnaset2b T C 17: 6,988,770 S12P probably damaging Het
Rrs1 C A 1: 9,545,801 probably null Het
Ryr2 T C 13: 11,759,703 E1189G probably damaging Het
Slc25a21 T A 12: 56,738,487 I202F probably benign Het
Tcfl5 A G 2: 180,622,647 V472A probably benign Het
Ttc12 A T 9: 49,458,187 probably benign Het
Ugt2b1 T G 5: 86,926,129 I124L probably benign Het
Usp14 A T 18: 9,997,763 N357K probably benign Het
Other mutations in Pwp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00707:Pwp1 APN 10 85878516 missense probably damaging 1.00
IGL00778:Pwp1 APN 10 85879888 missense probably benign 0.05
IGL01086:Pwp1 APN 10 85879893 splice site probably null
IGL02526:Pwp1 APN 10 85882103 splice site probably null
IGL02596:Pwp1 APN 10 85872018 splice site probably null
IGL03164:Pwp1 APN 10 85878503 missense probably benign 0.19
IGL03269:Pwp1 APN 10 85882904 missense probably damaging 0.98
Annuals UTSW 10 85876514 missense probably damaging 1.00
R0031:Pwp1 UTSW 10 85885896 missense probably benign 0.20
R0049:Pwp1 UTSW 10 85885616 missense possibly damaging 0.67
R0049:Pwp1 UTSW 10 85885616 missense possibly damaging 0.67
R0766:Pwp1 UTSW 10 85879309 missense probably damaging 0.98
R0926:Pwp1 UTSW 10 85876514 missense probably damaging 1.00
R1312:Pwp1 UTSW 10 85879309 missense probably damaging 0.98
R1420:Pwp1 UTSW 10 85876538 missense probably damaging 1.00
R3177:Pwp1 UTSW 10 85882079 missense probably benign 0.45
R3277:Pwp1 UTSW 10 85882079 missense probably benign 0.45
R3818:Pwp1 UTSW 10 85888129 missense possibly damaging 0.76
R4008:Pwp1 UTSW 10 85882034 missense possibly damaging 0.60
R5964:Pwp1 UTSW 10 85882886 missense probably damaging 1.00
R6252:Pwp1 UTSW 10 85874509 missense probably benign 0.00
R6280:Pwp1 UTSW 10 85874462 missense probably damaging 0.99
R6765:Pwp1 UTSW 10 85884533 missense probably damaging 0.99
R7168:Pwp1 UTSW 10 85884537 missense probably damaging 1.00
R7213:Pwp1 UTSW 10 85876309 missense probably benign
R7236:Pwp1 UTSW 10 85879283 missense probably benign 0.00
R7840:Pwp1 UTSW 10 85888050 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATGCACGTTCAGACAAGCCAATC -3'
(R):5'- TGTCCAGAGGCAGCTCTGAGTTAC -3'

Sequencing Primer
(F):5'- ACACAACGATGAAATCTCTGGTG -3'
(R):5'- CAGCTCTGAGTTACAGATAAGATGTG -3'
Posted On2014-01-29