Incidental Mutation 'R1339:Shc2'
ID156962
Institutional Source Beutler Lab
Gene Symbol Shc2
Ensembl Gene ENSMUSG00000020312
Gene NameSHC (Src homology 2 domain containing) transforming protein 2
SynonymsShcB, Sli
MMRRC Submission 039404-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1339 (G1)
Quality Score142
Status Not validated
Chromosome10
Chromosomal Location79618051-79637918 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 79626416 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 298 (T298P)
Ref Sequence ENSEMBL: ENSMUSP00000020564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020564]
Predicted Effect probably benign
Transcript: ENSMUST00000020564
AA Change: T298P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000020564
Gene: ENSMUSG00000020312
AA Change: T298P

DomainStartEndE-ValueType
PTB 1 154 4.43e-24 SMART
low complexity region 172 178 N/A INTRINSIC
SH2 341 420 5.81e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163867
AA Change: T298P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000129491
Gene: ENSMUSG00000020312
AA Change: T298P

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 67 85 N/A INTRINSIC
PTB 126 289 7.41e-35 SMART
low complexity region 307 313 N/A INTRINSIC
SH2 476 555 5.81e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166450
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168116
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display sensory nerve defects related to nociception. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik GCC GC 13: 59,691,598 probably null Het
Adamts20 A T 15: 94,322,896 N1385K probably benign Het
Cyp4a32 A G 4: 115,611,563 Y382C probably damaging Het
Dtnbp1 G A 13: 44,923,220 S237L probably damaging Het
Foxi1 T C 11: 34,205,866 T255A probably benign Het
Gm15448 A G 7: 3,822,156 Y496H probably damaging Het
Ifi208 A C 1: 173,683,238 T320P probably damaging Het
Inhbc C A 10: 127,357,641 V169L probably benign Het
Irf7 G A 7: 141,263,704 R320C probably damaging Het
March6 T C 15: 31,486,402 T336A probably benign Het
Masp1 C A 16: 23,452,467 C677F probably damaging Het
Mei1 A G 15: 82,081,995 R323G possibly damaging Het
Olfr13 G C 6: 43,174,610 G208A probably benign Het
Olfr421-ps1 G T 1: 174,152,211 G232C probably damaging Het
Rel C T 11: 23,745,763 C208Y probably damaging Het
Rsg1 A G 4: 141,218,548 E134G probably damaging Het
Syne1 G A 10: 5,367,571 L508F probably damaging Het
Ubn1 A G 16: 5,055,335 K74E probably damaging Het
Other mutations in Shc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Shc2 APN 10 79621069 missense probably damaging 1.00
IGL01586:Shc2 APN 10 79622304 missense probably damaging 0.99
IGL01965:Shc2 APN 10 79627189 splice site probably benign
IGL02149:Shc2 APN 10 79622268 missense probably damaging 1.00
IGL02252:Shc2 APN 10 79626370 missense probably benign 0.00
shrine UTSW 10 79629917 missense probably damaging 0.99
R0538:Shc2 UTSW 10 79630140 splice site probably benign
R0630:Shc2 UTSW 10 79626141 unclassified probably null
R0894:Shc2 UTSW 10 79629917 missense probably damaging 0.99
R1166:Shc2 UTSW 10 79621112 missense probably damaging 1.00
R1465:Shc2 UTSW 10 79631302 missense probably damaging 1.00
R1465:Shc2 UTSW 10 79631302 missense probably damaging 1.00
R1647:Shc2 UTSW 10 79626111 missense probably benign
R1648:Shc2 UTSW 10 79626111 missense probably benign
R1959:Shc2 UTSW 10 79626791 unclassified probably null
R3800:Shc2 UTSW 10 79626873 missense probably benign 0.40
R4603:Shc2 UTSW 10 79623856 missense probably benign 0.03
R4635:Shc2 UTSW 10 79626286 missense probably benign 0.35
R4656:Shc2 UTSW 10 79621169 missense probably damaging 1.00
R4715:Shc2 UTSW 10 79622379 missense probably benign 0.01
R4841:Shc2 UTSW 10 79622461 missense probably damaging 0.98
R4842:Shc2 UTSW 10 79622461 missense probably damaging 0.98
R5057:Shc2 UTSW 10 79623872 missense probably benign 0.01
R5394:Shc2 UTSW 10 79630099 missense probably damaging 1.00
R6153:Shc2 UTSW 10 79629918 missense possibly damaging 0.90
R6160:Shc2 UTSW 10 79627019 critical splice donor site probably null
R6178:Shc2 UTSW 10 79630120 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCTGCAAGAGAGGCATGATGAC -3'
(R):5'- CCAATATTCTGGACAGGGCACCAC -3'

Sequencing Primer
(F):5'- AGGCATGATGACCCTGCTATG -3'
(R):5'- CCTCCCATCCCATAGATTATGGTTC -3'
Posted On2014-02-11