Incidental Mutation 'R4635:Shc2'
ID349448
Institutional Source Beutler Lab
Gene Symbol Shc2
Ensembl Gene ENSMUSG00000020312
Gene NameSHC (Src homology 2 domain containing) transforming protein 2
SynonymsShcB, Sli
MMRRC Submission 041899-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4635 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location79618051-79637918 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 79626286 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 341 (C341Y)
Ref Sequence ENSEMBL: ENSMUSP00000020564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020564]
Predicted Effect probably benign
Transcript: ENSMUST00000020564
AA Change: C341Y

PolyPhen 2 Score 0.352 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000020564
Gene: ENSMUSG00000020312
AA Change: C341Y

DomainStartEndE-ValueType
PTB 1 154 4.43e-24 SMART
low complexity region 172 178 N/A INTRINSIC
SH2 341 420 5.81e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163867
AA Change: C341Y

PolyPhen 2 Score 0.352 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000129491
Gene: ENSMUSG00000020312
AA Change: C341Y

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 67 85 N/A INTRINSIC
PTB 126 289 7.41e-35 SMART
low complexity region 307 313 N/A INTRINSIC
SH2 476 555 5.81e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166450
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168116
Meta Mutation Damage Score 0.1198 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 98% (39/40)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display sensory nerve defects related to nociception. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik G A 5: 31,488,091 R396Q probably benign Het
Abcb1a A T 5: 8,714,927 K639I probably benign Het
Amer3 C A 1: 34,587,877 T399K probably damaging Het
Arfgef3 T C 10: 18,634,855 Y786C probably damaging Het
Arhgef26 A G 3: 62,340,440 Y315C probably damaging Het
Chchd6 T C 6: 89,467,466 E178G probably damaging Het
Chd3 TGCTGCCGCTGCCGC TGCTGCCGCTGCCGCTGCCGC 11: 69,362,187 probably benign Het
Daam1 T A 12: 71,958,744 probably null Het
Ddx60 A G 8: 62,037,067 E1690G probably benign Het
Eme2 G T 17: 24,894,908 P48T probably benign Het
Ferd3l T C 12: 33,928,836 M116T probably damaging Het
Gm13141 GGTTTCTTGATGCCA G 4: 147,528,104 noncoding transcript Het
Gm960 A G 19: 4,698,496 probably benign Het
Gtf2i T C 5: 134,245,174 N727D probably damaging Het
Hao1 T A 2: 134,523,152 N185I probably damaging Het
Kifap3 C T 1: 163,814,435 T195I probably damaging Het
Mag A G 7: 30,906,923 F363S probably damaging Het
Mef2a A G 7: 67,240,427 I135T possibly damaging Het
Muc4 T C 16: 32,753,802 I1226T probably benign Het
Nphs1 T C 7: 30,468,007 F787L probably benign Het
Nr1h2 A C 7: 44,552,537 S42A probably benign Het
Olfr1123 T A 2: 87,418,699 M217K probably benign Het
Olfr1249 A C 2: 89,630,172 I242S possibly damaging Het
Olfr612 T C 7: 103,539,148 I29V probably benign Het
Olfr993 T A 2: 85,414,864 N5I probably damaging Het
Rab38 T C 7: 88,450,646 V123A probably damaging Het
Scd1 T C 19: 44,406,585 Y67C probably damaging Het
Scn5a T C 9: 119,528,985 N730S possibly damaging Het
Tfdp2 T A 9: 96,297,674 N113K probably damaging Het
Tmc3 A G 7: 83,585,082 probably benign Het
Tox A T 4: 6,990,501 probably benign Het
Tspoap1 A G 11: 87,777,857 K1319E probably benign Het
Ttc25 C T 11: 100,551,507 Q164* probably null Het
Vit G A 17: 78,574,212 V135I probably benign Het
Vwa5b1 T G 4: 138,610,839 S71R possibly damaging Het
Other mutations in Shc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Shc2 APN 10 79621069 missense probably damaging 1.00
IGL01586:Shc2 APN 10 79622304 missense probably damaging 0.99
IGL01965:Shc2 APN 10 79627189 splice site probably benign
IGL02149:Shc2 APN 10 79622268 missense probably damaging 1.00
IGL02252:Shc2 APN 10 79626370 missense probably benign 0.00
shrine UTSW 10 79629917 missense probably damaging 0.99
R0538:Shc2 UTSW 10 79630140 splice site probably benign
R0630:Shc2 UTSW 10 79626141 unclassified probably null
R0894:Shc2 UTSW 10 79629917 missense probably damaging 0.99
R1166:Shc2 UTSW 10 79621112 missense probably damaging 1.00
R1339:Shc2 UTSW 10 79626416 missense probably benign 0.00
R1465:Shc2 UTSW 10 79631302 missense probably damaging 1.00
R1465:Shc2 UTSW 10 79631302 missense probably damaging 1.00
R1647:Shc2 UTSW 10 79626111 missense probably benign
R1648:Shc2 UTSW 10 79626111 missense probably benign
R1959:Shc2 UTSW 10 79626791 unclassified probably null
R3800:Shc2 UTSW 10 79626873 missense probably benign 0.40
R4603:Shc2 UTSW 10 79623856 missense probably benign 0.03
R4656:Shc2 UTSW 10 79621169 missense probably damaging 1.00
R4715:Shc2 UTSW 10 79622379 missense probably benign 0.01
R4841:Shc2 UTSW 10 79622461 missense probably damaging 0.98
R4842:Shc2 UTSW 10 79622461 missense probably damaging 0.98
R5057:Shc2 UTSW 10 79623872 missense probably benign 0.01
R5394:Shc2 UTSW 10 79630099 missense probably damaging 1.00
R6153:Shc2 UTSW 10 79629918 missense possibly damaging 0.90
R6160:Shc2 UTSW 10 79627019 critical splice donor site probably null
R6178:Shc2 UTSW 10 79630120 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGCAGGACACAGCTACATG -3'
(R):5'- GCTCTAACGTACATGCCTTGC -3'

Sequencing Primer
(F):5'- AACCTACCTGCTCCAGAGGG -3'
(R):5'- AACGTACATGCCTTGCTCTGTG -3'
Posted On2015-10-08