Incidental Mutation 'R1312:4921539E11Rik'
ID157960
Institutional Source Beutler Lab
Gene Symbol 4921539E11Rik
Ensembl Gene ENSMUSG00000028520
Gene NameRIKEN cDNA 4921539E11 gene
Synonyms
MMRRC Submission 039378-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R1312 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location103230445-103290863 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103270797 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 44 (F44I)
Ref Sequence ENSEMBL: ENSMUSP00000095557 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030245] [ENSMUST00000097944] [ENSMUST00000168664]
Predicted Effect probably damaging
Transcript: ENSMUST00000030245
AA Change: F44I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000030245
Gene: ENSMUSG00000028520
AA Change: F44I

DomainStartEndE-ValueType
Pfam:DUF4545 1 443 6.1e-206 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000097944
AA Change: F44I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000095557
Gene: ENSMUSG00000028520
AA Change: F44I

DomainStartEndE-ValueType
Pfam:DUF4545 1 270 7.3e-116 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168664
SMART Domains Protein: ENSMUSP00000131846
Gene: ENSMUSG00000028520

DomainStartEndE-ValueType
Pfam:DUF4545 1 342 4.4e-183 PFAM
Meta Mutation Damage Score 0.2271 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.0%
  • 20x: 85.7%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot10 A G 15: 20,666,499 V52A probably benign Het
Arhgap32 T C 9: 32,255,312 V415A probably benign Het
Cacna2d3 T C 14: 29,045,668 D750G probably benign Het
Cdh15 G A 8: 122,861,449 probably benign Het
Dusp27 A T 1: 166,099,291 N917K possibly damaging Het
Edem2 T G 2: 155,702,585 D415A probably damaging Het
Eml6 A G 11: 29,831,219 probably benign Het
Ercc5 T C 1: 44,164,019 F272S probably damaging Het
Fcamr C T 1: 130,811,487 R175C probably damaging Het
Frem3 G A 8: 80,615,322 V1415I probably benign Het
Fry T C 5: 150,403,432 probably benign Het
Gm14443 A T 2: 175,171,590 probably benign Het
Insrr A G 3: 87,800,490 T80A probably damaging Het
Itih2 T A 2: 10,097,924 T800S probably benign Het
Lgals9 G A 11: 78,976,617 Q42* probably null Het
Lrrk2 A G 15: 91,699,895 N286S probably damaging Het
Mefv A G 16: 3,708,534 probably benign Het
Mkx T A 18: 6,937,192 D284V probably benign Het
Olfr743 T A 14: 50,534,195 I261K probably benign Het
Pde1b T G 15: 103,526,273 S339A possibly damaging Het
Plch2 C T 4: 154,989,799 V765M probably damaging Het
Ppp4r3b A T 11: 29,173,358 Q18L probably benign Het
Psme4 T A 11: 30,807,687 probably null Het
Pwp1 G A 10: 85,879,309 D220N probably damaging Het
Rel G A 11: 23,757,010 T64I probably damaging Het
Rho C G 6: 115,935,605 N160K probably damaging Het
Skiv2l2 A C 13: 112,883,251 L775* probably null Het
Sntb2 A G 8: 107,001,577 T386A probably damaging Het
Sucla2 C T 14: 73,560,634 probably benign Het
Ttc30a2 A T 2: 75,976,332 V612D probably benign Het
Vcp T C 4: 42,988,728 T249A possibly damaging Het
Vmn1r167 A G 7: 23,505,123 F156S probably benign Het
Vrk2 G A 11: 26,535,522 probably benign Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp638 A G 6: 83,929,041 N63D probably damaging Het
Other mutations in 4921539E11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:4921539E11Rik APN 4 103235786 missense possibly damaging 0.95
IGL00864:4921539E11Rik APN 4 103235698 missense probably damaging 1.00
IGL01951:4921539E11Rik APN 4 103235668 missense probably damaging 1.00
IGL02477:4921539E11Rik APN 4 103270746 missense probably benign 0.04
IGL02606:4921539E11Rik APN 4 103242781 missense probably benign 0.01
IGL03210:4921539E11Rik APN 4 103284438 missense probably benign 0.01
R0441:4921539E11Rik UTSW 4 103235492 intron probably benign
R0455:4921539E11Rik UTSW 4 103230983 missense possibly damaging 0.69
R0504:4921539E11Rik UTSW 4 103270860 splice site probably benign
R0636:4921539E11Rik UTSW 4 103231217 missense probably damaging 1.00
R0766:4921539E11Rik UTSW 4 103270797 missense probably damaging 0.99
R0799:4921539E11Rik UTSW 4 103242904 missense possibly damaging 0.83
R1713:4921539E11Rik UTSW 4 103270767 missense possibly damaging 0.92
R1783:4921539E11Rik UTSW 4 103231089 missense probably damaging 0.99
R1978:4921539E11Rik UTSW 4 103270764 missense possibly damaging 0.49
R3735:4921539E11Rik UTSW 4 103266406 missense probably damaging 1.00
R4821:4921539E11Rik UTSW 4 103235674 missense probably damaging 1.00
R5274:4921539E11Rik UTSW 4 103235659 missense probably benign 0.22
R5275:4921539E11Rik UTSW 4 103235659 missense probably benign 0.22
R5431:4921539E11Rik UTSW 4 103270848 missense probably benign 0.00
R5449:4921539E11Rik UTSW 4 103266382 missense probably benign
R6049:4921539E11Rik UTSW 4 103231323 missense probably benign 0.05
R6277:4921539E11Rik UTSW 4 103231471 nonsense probably null
R6518:4921539E11Rik UTSW 4 103266411 missense probably damaging 1.00
R6602:4921539E11Rik UTSW 4 103255572 missense probably benign 0.36
R6634:4921539E11Rik UTSW 4 103236930 critical splice donor site probably null
R6992:4921539E11Rik UTSW 4 103242793 missense possibly damaging 0.57
R7575:4921539E11Rik UTSW 4 103230995 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCCAGCTACACCAGCCTCAAA -3'
(R):5'- gtgtgtTTAGAGAGAAAGGGAGAATGATTCA -3'

Sequencing Primer
(F):5'- cccttgcctctaccttctg -3'
(R):5'- AGAATACTGACCGTCACCAC -3'
Posted On2014-02-18