Incidental Mutation 'R1393:Atg4d'
ID162698
Institutional Source Beutler Lab
Gene Symbol Atg4d
Ensembl Gene ENSMUSG00000002820
Gene Nameautophagy related 4D, cysteine peptidase
Synonyms9830134P12Rik, APG4-D, Apg4d, Autl4
MMRRC Submission 039455-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1393 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location21265293-21277772 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 21270833 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 317 (Y317N)
Ref Sequence ENSEMBL: ENSMUSP00000068450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038671] [ENSMUST00000065005] [ENSMUST00000184326]
Predicted Effect probably benign
Transcript: ENSMUST00000038671
SMART Domains Protein: ENSMUSP00000039688
Gene: ENSMUSG00000035047

DomainStartEndE-ValueType
low complexity region 20 34 N/A INTRINSIC
low complexity region 50 60 N/A INTRINSIC
low complexity region 98 112 N/A INTRINSIC
low complexity region 181 195 N/A INTRINSIC
Pfam:Kri1 346 439 3.2e-27 PFAM
Pfam:Kri1_C 507 595 8.4e-37 PFAM
low complexity region 653 666 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000065005
AA Change: Y317N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068450
Gene: ENSMUSG00000002820
AA Change: Y317N

DomainStartEndE-ValueType
low complexity region 39 53 N/A INTRINSIC
Pfam:Peptidase_C54 109 411 5.7e-107 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184326
SMART Domains Protein: ENSMUSP00000139184
Gene: ENSMUSG00000035047

DomainStartEndE-ValueType
low complexity region 57 71 N/A INTRINSIC
Pfam:Kri1 207 317 4.4e-27 PFAM
Pfam:Kri1_C 381 472 3.6e-36 PFAM
low complexity region 529 542 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192279
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215767
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216826
Predicted Effect probably benign
Transcript: ENSMUST00000217269
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217591
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Autophagy is the process by which endogenous proteins and damaged organelles are destroyed intracellularly. Autophagy is postulated to be essential for cell homeostasis and cell remodeling during differentiation, metamorphosis, non-apoptotic cell death, and aging. Reduced levels of autophagy have been described in some malignant tumors, and a role for autophagy in controlling the unregulated cell growth linked to cancer has been proposed. This gene belongs to the autophagy-related protein 4 (Atg4) family of C54 endopeptidases. Members of this family encode proteins that play a role in the biogenesis of autophagosomes, which sequester the cytosol and organelles for degradation by lysosomes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 A G 16: 20,560,430 N682S probably benign Het
Acta2 G A 19: 34,241,792 R337C probably damaging Het
Anxa5 G A 3: 36,453,509 T194I probably damaging Het
Atf1 A G 15: 100,232,766 T6A possibly damaging Het
Bcl6 A G 16: 23,977,566 V37A probably damaging Het
Bsn T C 9: 108,110,517 probably benign Het
Cd300ld2 G A 11: 115,012,578 probably benign Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Chad A T 11: 94,565,314 M73L probably benign Het
Copz1 A G 15: 103,294,744 N95S probably benign Het
Cwf19l2 T C 9: 3,456,818 V717A probably benign Het
Dock3 C T 9: 106,911,349 G140R probably damaging Het
Gm14226 A T 2: 155,024,191 S23C probably damaging Het
Gria2 T C 3: 80,707,098 E545G probably damaging Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr811 A G 10: 129,801,932 F198L probably benign Het
Patj G A 4: 98,424,411 V329I probably benign Het
Ptcd3 T A 6: 71,889,621 T404S probably benign Het
Rasa1 A G 13: 85,223,522 C867R probably damaging Het
Rps24 A G 14: 24,491,762 T6A probably damaging Het
Rsad2 T C 12: 26,456,377 S15G probably damaging Het
Serpina12 T C 12: 104,037,750 I208V possibly damaging Het
Spock1 A T 13: 57,907,454 L45Q probably damaging Het
Stat3 A T 11: 100,888,765 probably null Het
Zfp810 T C 9: 22,280,514 D90G probably benign Het
Other mutations in Atg4d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Atg4d APN 9 21266921 missense probably damaging 1.00
R1455:Atg4d UTSW 9 21270801 missense probably damaging 1.00
R1724:Atg4d UTSW 9 21268445 missense probably damaging 1.00
R1912:Atg4d UTSW 9 21272639 missense probably damaging 1.00
R2497:Atg4d UTSW 9 21273386 nonsense probably null
R5366:Atg4d UTSW 9 21268652 missense probably damaging 1.00
R6563:Atg4d UTSW 9 21268460 missense possibly damaging 0.80
R6709:Atg4d UTSW 9 21268648 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATAAAAGGTGACCTGCTGCCCTG -3'
(R):5'- GACCTGCGTTCAATCCCTAGAACC -3'

Sequencing Primer
(F):5'- CTGCTGCCCTGTCCCTG -3'
(R):5'- tgtggagggcagaaatgg -3'
Posted On2014-03-17