Incidental Mutation 'R1393:Bcl6'
Institutional Source Beutler Lab
Gene Symbol Bcl6
Ensembl Gene ENSMUSG00000022508
Gene NameB cell leukemia/lymphoma 6
MMRRC Submission 039455-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.942) question?
Stock #R1393 (G1)
Quality Score225
Status Not validated
Chromosomal Location23965052-23988852 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23977566 bp
Amino Acid Change Valine to Alanine at position 37 (V37A)
Ref Sequence ENSEMBL: ENSMUSP00000023151 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023151]
Predicted Effect probably damaging
Transcript: ENSMUST00000023151
AA Change: V37A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000023151
Gene: ENSMUSG00000022508
AA Change: V37A

BTB 32 129 4.86e-28 SMART
low complexity region 406 422 N/A INTRINSIC
low complexity region 458 467 N/A INTRINSIC
ZnF_C2H2 519 542 1.33e-1 SMART
ZnF_C2H2 547 569 1.67e-2 SMART
ZnF_C2H2 575 597 2.79e-4 SMART
ZnF_C2H2 603 625 3.89e-3 SMART
ZnF_C2H2 631 653 8.47e-4 SMART
ZnF_C2H2 659 682 4.11e-2 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcription factor and contains an N-terminal POZ domain. This protein acts as a sequence-specific repressor of transcription, and has been shown to modulate the transcription of STAT-dependent IL-4 responses of B cells. This protein can interact with a variety of POZ-containing proteins that function as transcription corepressors. This gene is found to be frequently translocated and hypermutated in diffuse large-cell lymphoma (DLCL), and may be involved in the pathogenesis of DLCL. Alternatively spliced transcript variants encoding different protein isoforms have been found for this gene. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous null mutants develop myocarditis and pulmonary vasculitis, show impaired germinal center formation in the spleen, and display T helper 2 cell hyperimmune responsiveness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 A G 16: 20,560,430 N682S probably benign Het
Acta2 G A 19: 34,241,792 R337C probably damaging Het
Anxa5 G A 3: 36,453,509 T194I probably damaging Het
Atf1 A G 15: 100,232,766 T6A possibly damaging Het
Atg4d T A 9: 21,270,833 Y317N probably damaging Het
Bsn T C 9: 108,110,517 probably benign Het
Cd300ld2 G A 11: 115,012,578 probably benign Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Chad A T 11: 94,565,314 M73L probably benign Het
Copz1 A G 15: 103,294,744 N95S probably benign Het
Cwf19l2 T C 9: 3,456,818 V717A probably benign Het
Dock3 C T 9: 106,911,349 G140R probably damaging Het
Gm14226 A T 2: 155,024,191 S23C probably damaging Het
Gria2 T C 3: 80,707,098 E545G probably damaging Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr811 A G 10: 129,801,932 F198L probably benign Het
Patj G A 4: 98,424,411 V329I probably benign Het
Ptcd3 T A 6: 71,889,621 T404S probably benign Het
Rasa1 A G 13: 85,223,522 C867R probably damaging Het
Rps24 A G 14: 24,491,762 T6A probably damaging Het
Rsad2 T C 12: 26,456,377 S15G probably damaging Het
Serpina12 T C 12: 104,037,750 I208V possibly damaging Het
Spock1 A T 13: 57,907,454 L45Q probably damaging Het
Stat3 A T 11: 100,888,765 probably null Het
Zfp810 T C 9: 22,280,514 D90G probably benign Het
Other mutations in Bcl6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02220:Bcl6 APN 16 23974891 missense probably damaging 1.00
IGL02505:Bcl6 APN 16 23977569 missense probably damaging 1.00
IGL03052:Bcl6 APN 16 23975038 splice site probably benign
IGL03271:Bcl6 APN 16 23970006 missense probably benign 0.00
Adriatic UTSW 16 23968133 missense probably damaging 0.99
Catanzaro UTSW 16 23966226 nonsense probably null
Density UTSW 16 23970048 missense possibly damaging 0.91
nouvelle UTSW 16 23969986 missense possibly damaging 0.92
R0220:Bcl6 UTSW 16 23966219 missense possibly damaging 0.95
R0401:Bcl6 UTSW 16 23972594 missense probably damaging 0.97
R0734:Bcl6 UTSW 16 23968139 missense probably damaging 0.99
R1105:Bcl6 UTSW 16 23966155 missense probably benign
R1134:Bcl6 UTSW 16 23968365 missense probably benign
R1317:Bcl6 UTSW 16 23977542 missense probably damaging 1.00
R1325:Bcl6 UTSW 16 23972347 missense probably benign 0.02
R1761:Bcl6 UTSW 16 23977542 missense probably damaging 1.00
R2170:Bcl6 UTSW 16 23974930 missense probably damaging 1.00
R2220:Bcl6 UTSW 16 23972632 nonsense probably null
R2293:Bcl6 UTSW 16 23977609 missense probably damaging 0.98
R2907:Bcl6 UTSW 16 23968119 missense probably damaging 1.00
R3900:Bcl6 UTSW 16 23977554 missense possibly damaging 0.94
R4681:Bcl6 UTSW 16 23968453 intron probably benign
R5015:Bcl6 UTSW 16 23974850 missense probably damaging 0.98
R5112:Bcl6 UTSW 16 23972746 missense probably benign
R5185:Bcl6 UTSW 16 23972947 missense possibly damaging 0.77
R5371:Bcl6 UTSW 16 23969986 missense possibly damaging 0.92
R5586:Bcl6 UTSW 16 23973176 missense probably benign 0.01
R5659:Bcl6 UTSW 16 23968409 nonsense probably null
R5909:Bcl6 UTSW 16 23972806 missense probably benign
R6384:Bcl6 UTSW 16 23974865 missense probably damaging 1.00
R7036:Bcl6 UTSW 16 23974861 missense probably damaging 1.00
R7097:Bcl6 UTSW 16 23972614 missense possibly damaging 0.94
R7097:Bcl6 UTSW 16 23972902 missense probably damaging 1.00
R7122:Bcl6 UTSW 16 23972902 missense probably damaging 1.00
R7153:Bcl6 UTSW 16 23966226 nonsense probably null
R7154:Bcl6 UTSW 16 23966226 nonsense probably null
R7155:Bcl6 UTSW 16 23966226 nonsense probably null
R7156:Bcl6 UTSW 16 23966226 nonsense probably null
R7163:Bcl6 UTSW 16 23966226 nonsense probably null
R7164:Bcl6 UTSW 16 23966226 nonsense probably null
R7434:Bcl6 UTSW 16 23970048 missense possibly damaging 0.91
R7727:Bcl6 UTSW 16 23971413 critical splice donor site probably null
R7914:Bcl6 UTSW 16 23970011 missense possibly damaging 0.68
R8230:Bcl6 UTSW 16 23972902 missense probably damaging 1.00
R8243:Bcl6 UTSW 16 23968133 missense probably damaging 0.99
R8399:Bcl6 UTSW 16 23972948 missense probably benign 0.39
Z1176:Bcl6 UTSW 16 23969958 missense probably damaging 0.99
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- acagctatgcaaagcaaagtc -3'
Posted On2014-03-17