Incidental Mutation 'R1494:Tagap1'
ID163843
Institutional Source Beutler Lab
Gene Symbol Tagap1
Ensembl Gene ENSMUSG00000052031
Gene NameT cell activation GTPase activating protein 1
Synonyms
MMRRC Submission 039545-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1494 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location6955011-6961156 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 6956811 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 162 (D162G)
Ref Sequence ENSEMBL: ENSMUSP00000070466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063683]
Predicted Effect probably damaging
Transcript: ENSMUST00000063683
AA Change: D162G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070466
Gene: ENSMUSG00000052031
AA Change: D162G

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
low complexity region 141 152 N/A INTRINSIC
low complexity region 250 269 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231833
Meta Mutation Damage Score 0.1073 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.3%
Validation Efficiency 97% (57/59)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik A G 17: 48,090,471 E92G probably benign Het
Abca13 C T 11: 9,466,429 Q4064* probably null Het
Abca14 G A 7: 120,216,301 M257I probably benign Het
Acsm2 T A 7: 119,575,632 C207S probably damaging Het
Actr3 A G 1: 125,416,281 I67T probably benign Het
Adcy7 T C 8: 88,320,207 V606A probably benign Het
Ahnak2 G A 12: 112,787,950 S54F probably damaging Het
Ano6 T C 15: 95,972,507 S848P probably damaging Het
Atg3 C T 16: 45,171,760 probably benign Het
Atp8b1 T A 18: 64,564,526 S416C probably damaging Het
C2cd5 A G 6: 143,041,346 probably benign Het
Capn11 A T 17: 45,643,809 V134E probably damaging Het
Ccnd3 A G 17: 47,598,108 probably null Het
Chaf1b T A 16: 93,888,110 V149E probably damaging Het
Col5a2 T A 1: 45,502,914 M1L unknown Het
Copa T C 1: 172,104,127 I315T probably benign Het
Cyp3a57 A G 5: 145,381,267 M353V probably damaging Het
Dcaf6 T C 1: 165,333,373 M828V probably damaging Het
Dock2 T A 11: 34,282,761 K1080* probably null Het
Dock6 A G 9: 21,814,742 V1424A probably benign Het
Foxa1 T C 12: 57,542,198 D412G probably damaging Het
Foxp4 G C 17: 47,880,353 probably benign Het
Galnt9 T A 5: 110,588,330 S171T probably damaging Het
Glt6d1 A G 2: 25,794,248 Y249H probably damaging Het
Gm37240 A T 3: 84,527,691 Y104N probably damaging Het
Gpx8 C T 13: 113,045,615 E95K possibly damaging Het
Grm1 T C 10: 10,689,706 T953A probably benign Het
Helz T C 11: 107,604,063 probably benign Het
Hif3a T C 7: 17,054,722 Y108C probably damaging Het
Kcnj13 A T 1: 87,389,217 L58Q probably damaging Het
Mfsd14b A T 13: 65,095,671 V53D probably damaging Het
Mrps7 G C 11: 115,604,126 probably benign Het
Mug1 G A 6: 121,879,300 G1013D probably damaging Het
Olfr652 T A 7: 104,564,831 Y203* probably null Het
Olfr767 A T 10: 129,079,615 M116K probably damaging Het
Pax6 T C 2: 105,691,610 I19T probably benign Het
Pde8b G A 13: 95,047,796 R416C probably damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Pygl G A 12: 70,199,730 R348W probably damaging Het
Ralgapa1 T A 12: 55,684,524 D1874V probably damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Sncaip T C 18: 52,868,886 S160P probably damaging Het
Sptbn4 A G 7: 27,434,294 V79A probably damaging Het
Sptlc3 A T 2: 139,589,560 Y334F possibly damaging Het
Supt16 A G 14: 52,172,459 Y764H probably benign Het
Syne3 A T 12: 104,955,582 V438E possibly damaging Het
Terb1 T C 8: 104,498,490 probably benign Het
Themis3 C A 17: 66,559,954 R97L probably benign Het
Tnk1 T A 11: 69,856,546 E86D possibly damaging Het
Tnpo3 A G 6: 29,557,044 L53P probably damaging Het
Trpc6 G A 9: 8,658,304 R725K probably benign Het
Ttll11 T G 2: 35,795,379 T566P probably damaging Het
Unc5c A T 3: 141,827,549 T779S possibly damaging Het
Zfp42 A G 8: 43,295,601 C288R possibly damaging Het
Zfp763 G A 17: 33,021,503 T52I probably damaging Het
Other mutations in Tagap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01384:Tagap1 APN 17 6956883 missense probably benign 0.00
IGL02138:Tagap1 APN 17 6956086 missense probably damaging 1.00
IGL02475:Tagap1 APN 17 6956427 missense probably benign 0.41
IGL02955:Tagap1 APN 17 6956382 missense probably damaging 1.00
R1824:Tagap1 UTSW 17 6956026 missense probably benign 0.02
R1990:Tagap1 UTSW 17 6956886 missense probably benign 0.00
R2067:Tagap1 UTSW 17 6956860 missense probably benign 0.00
R2086:Tagap1 UTSW 17 6956703 missense probably benign 0.00
R2111:Tagap1 UTSW 17 6956860 missense probably benign 0.00
R4425:Tagap1 UTSW 17 6956112 missense probably benign 0.00
R5271:Tagap1 UTSW 17 6956096 nonsense probably null
R5728:Tagap1 UTSW 17 6957021 missense probably benign 0.30
R7100:Tagap1 UTSW 17 6956712 missense possibly damaging 0.83
Z1177:Tagap1 UTSW 17 6956617 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTCCCTGTGGAGATGCTAAACCTTG -3'
(R):5'- GCCTATGACAGCAATGACCCAGATG -3'

Sequencing Primer
(F):5'- TCAAATCCACAGGTCTCTTGG -3'
(R):5'- ATGACCCAGATGTGGAGCC -3'
Posted On2014-03-28