Incidental Mutation 'R1506:Rps14'
ID167964
Institutional Source Beutler Lab
Gene Symbol Rps14
Ensembl Gene ENSMUSG00000024608
Gene Nameribosomal protein S14
Synonyms
MMRRC Submission 039554-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.931) question?
Stock #R1506 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location60774510-60778546 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 60776479 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 26 (N26I)
Ref Sequence ENSEMBL: ENSMUSP00000113504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025511] [ENSMUST00000118551] [ENSMUST00000122279] [ENSMUST00000127568] [ENSMUST00000137400]
Predicted Effect probably benign
Transcript: ENSMUST00000025511
AA Change: N26I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000025511
Gene: ENSMUSG00000024608
AA Change: N26I

DomainStartEndE-ValueType
Pfam:Ribosomal_S11 29 147 3.2e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118088
Predicted Effect probably benign
Transcript: ENSMUST00000118551
AA Change: N26I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000113081
Gene: ENSMUSG00000024608
AA Change: N26I

DomainStartEndE-ValueType
Pfam:Ribosomal_S11 29 147 8.7e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122279
AA Change: N26I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000113504
Gene: ENSMUSG00000024608
AA Change: N26I

DomainStartEndE-ValueType
Pfam:Ribosomal_S11 29 147 8.7e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127568
AA Change: N26I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000114478
Gene: ENSMUSG00000024608
AA Change: N26I

DomainStartEndE-ValueType
Pfam:Ribosomal_S11 29 119 4.2e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137400
AA Change: N26I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000122985
Gene: ENSMUSG00000024608
AA Change: N26I

DomainStartEndE-ValueType
Pfam:Ribosomal_S11 29 138 8.2e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142980
Meta Mutation Damage Score 0.0746 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.7%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S11P family of ribosomal proteins. It is located in the cytoplasm. Transcript variants utilizing alternative transcription initiation sites have been described in the literature. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. In Chinese hamster ovary cells, mutations in this gene can lead to resistance to emetine, a protein synthesis inhibitor. Multiple alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Conditional heterozygous knockout in hematopoietic cells leads to reduced protein synthesis, resulting in progressive anemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 G T 11: 94,357,318 T1152K possibly damaging Het
Acpp T A 9: 104,324,174 T82S probably damaging Het
Adam23 C T 1: 63,547,814 P445S probably benign Het
Ap3b1 T A 13: 94,446,143 probably benign Het
Artn A G 4: 117,926,861 V136A probably damaging Het
Ash1l A G 3: 89,058,499 T2403A probably damaging Het
Bbof1 G T 12: 84,423,499 V120L probably damaging Het
Boc A G 16: 44,503,565 Y158H probably damaging Het
Casp8 A G 1: 58,824,196 E105G probably damaging Het
Cers4 T C 8: 4,520,557 F206L probably benign Het
Chrna9 A G 5: 65,969,136 T78A probably benign Het
Creb3 A T 4: 43,566,193 T263S possibly damaging Het
Cyp2c40 A G 19: 39,777,999 V384A probably damaging Het
Dip2b G A 15: 100,183,113 V879M probably damaging Het
Dnah17 C A 11: 118,125,387 V14F possibly damaging Het
Epb41l4b T A 4: 57,088,824 K144N probably damaging Het
Ercc6 A T 14: 32,569,864 I1062F probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam160b1 A G 19: 57,368,575 I33V probably benign Het
Fat2 C A 11: 55,284,264 E1874D probably benign Het
Fbxw21 T A 9: 109,148,189 I151F probably damaging Het
Foxn1 A G 11: 78,365,935 probably benign Het
Gm1966 C T 7: 106,601,581 D819N probably benign Het
Gpr63 G A 4: 25,008,227 R317H probably damaging Het
Grip1 C A 10: 119,978,451 H296N probably damaging Het
Gtdc1 A T 2: 44,575,494 M288K possibly damaging Het
Guf1 T A 5: 69,567,166 D488E possibly damaging Het
Heatr5b C A 17: 78,753,147 R2033L probably damaging Het
Hsd17b2 T A 8: 117,702,265 probably null Het
Ino80 A T 2: 119,425,265 L913* probably null Het
Inppl1 A C 7: 101,823,967 S1159A probably benign Het
Kcnk7 G A 19: 5,706,112 C122Y probably damaging Het
Mtor A G 4: 148,536,505 probably benign Het
Muc4 A T 16: 32,752,233 S704C possibly damaging Het
Nckap5 A T 1: 126,025,913 C967* probably null Het
Nek10 T C 14: 14,999,078 probably benign Het
Oas1h A T 5: 120,871,888 D342V possibly damaging Het
Olfr134 A T 17: 38,175,200 M39L probably benign Het
Olfr320 T A 11: 58,684,188 L105Q probably benign Het
Olfr418 A G 1: 173,270,769 N198S probably benign Het
Olfr734 A G 14: 50,320,484 V117A probably benign Het
Olfr904 T C 9: 38,464,143 M34T probably benign Het
Prex1 A T 2: 166,587,081 V694E probably damaging Het
Rad50 G A 11: 53,679,485 A810V probably damaging Het
Rcor1 T C 12: 111,109,837 S410P probably damaging Het
Slc38a1 T C 15: 96,585,550 D299G probably benign Het
Slc5a1 T A 5: 33,154,708 N481K possibly damaging Het
Slco3a1 A T 7: 74,359,935 probably null Het
Speg A G 1: 75,417,663 T1701A probably benign Het
Spg20 T C 3: 55,117,571 S196P probably damaging Het
Sugt1 A G 14: 79,624,925 N271S probably benign Het
Tbx15 A T 3: 99,351,912 L366F possibly damaging Het
Tnc G A 4: 64,007,684 T953I possibly damaging Het
Uqcc1 A G 2: 155,911,818 S46P probably damaging Het
Vmn2r18 T C 5: 151,575,634 probably null Het
Vmn2r7 T A 3: 64,707,079 Y438F probably benign Het
Vmn2r72 T A 7: 85,749,211 K520N probably benign Het
Vps52 T C 17: 33,957,894 L74P probably damaging Het
Xpo5 G T 17: 46,227,888 M673I probably benign Het
Zscan18 A G 7: 12,774,202 V457A probably damaging Het
Other mutations in Rps14
AlleleSourceChrCoordTypePredicted EffectPPH Score
Olive_oyl UTSW 18 60776961 missense possibly damaging 0.60
R5704:Rps14 UTSW 18 60777133 intron probably benign
R6294:Rps14 UTSW 18 60776961 missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- GAGACCCGACTTCCATGCTGTTAC -3'
(R):5'- AACTCCTTTGAGTCAGCAAGCTCTG -3'

Sequencing Primer
(F):5'- ACATAGCAACTTGTGCATGTGG -3'
(R):5'- ccagcaagggggcagag -3'
Posted On2014-04-13