Mutagenetix > Incidental Mutation

Incidental Mutation 'R1404:Skp2'

188671

Institutional Source

Beutler Lab

Gene Symbol

Skp2

Ensembl Gene

ENSMUSG00000054115

Gene Name

S-phase kinase-associated protein 2 (p45)

Synonyms

FBXL1

MMRRC Submission

039466-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1404 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

9111985-9155425 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 9116925 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 298 (Q298*)

Ref Sequence

ENSEMBL: ENSMUSP00000139997 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096482] [ENSMUST00000110585] [ENSMUST00000190131]

AlphaFold

Q9Z0Z3

Predicted Effect

probably null
Transcript: ENSMUST00000096482
AA Change: Q333*

SMART Domains

Protein: ENSMUSP00000094225
Gene: ENSMUSG00000054115
AA Change: Q333*

Domain	Start	End	E-Value	Type
FBOX	100	140	3.7e-8	SMART
LRR	205	229	1.27e2	SMART
LRR	230	254	1.28e1	SMART
LRR	255	280	2.91e1	SMART
LRR	334	359	2.83e1	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000110585
AA Change: Q333*

SMART Domains

Protein: ENSMUSP00000106215
Gene: ENSMUSG00000054115
AA Change: Q333*

Domain	Start	End	E-Value	Type
FBOX	100	140	3.7e-8	SMART
Blast:LRR	205	229	5e-7	BLAST
Blast:LRR	229	253	3e-7	BLAST
Blast:LRR	255	284	3e-10	BLAST
Blast:LRR	309	334	3e-8	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000190131
AA Change: Q298*

SMART Domains

Protein: ENSMUSP00000139997
Gene: ENSMUSG00000054115
AA Change: Q298*

Domain	Start	End	E-Value	Type
FBOX	65	105	2.3e-10	SMART
LRR	170	194	5.3e-1	SMART
LRR	195	219	5.3e-2	SMART
LRR	220	245	1.2e-1	SMART
LRR	299	324	1.2e-1	SMART

Meta Mutation Damage Score

0.9756

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.1%
20x: 92.0%

Validation Efficiency

100% (28/28)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbls class; in addition to an F-box, this protein contains 10 tandem leucine-rich repeats. This protein is an essential element of the cyclin A-CDK2 S-phase kinase. It specifically recognizes phosphorylated cyclin-dependent kinase inhibitor 1B (CDKN1B, also referred to as p27 or KIP1) predominantly in S phase and interacts with S-phase kinase-associated protein 1 (SKP1 or p19). In addition, this gene is established as a protooncogene causally involved in the pathogenesis of lymphomas. Alternative splicing of this gene generates three transcript variants encoding different isoforms. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced body weight, enlarged cell and nuclear sizes, polyploidy, reduced cell growth rate, overduplication of centrosomes, increased apoptosis rate, delayed wound healing, and aberrant immunoglobulin V(D)J recombination. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca1	G	A	4: 53,059,253		probably benign	Het
Actl6a	T	C	3: 32,722,610		probably benign	Het
Aox2	T	C	1: 58,346,212		probably benign	Het
Arrdc3	A	G	13: 80,883,854	T69A	probably damaging	Het
Bbs2	T	C	8: 94,081,999	K360R	probably null	Het
Cdh8	A	T	8: 99,279,618	N112K	probably damaging	Het
Ces5a	A	T	8: 93,502,181	F474I	probably damaging	Het
Doxl2	A	T	6: 48,975,833	T231S	probably benign	Het
Dync1i1	G	A	6: 5,915,876	D253N	probably damaging	Het
Fam151b	T	C	13: 92,473,972	D103G	probably damaging	Het
Fam227b	A	G	2: 126,003,839	L410P	probably damaging	Het
Ihh	A	T	1: 74,951,213	M1K	probably null	Het
Itga6	A	G	2: 71,838,716	T617A	probably benign	Het
Itpr1	T	A	6: 108,386,648	C744S	probably benign	Het
Kif5a	T	C	10: 127,245,442	I208V	probably benign	Het
Lama4	A	G	10: 39,061,391	K659R	probably benign	Het
Lpin3	T	A	2: 160,892,390		probably null	Het
Macf1	T	A	4: 123,376,516	E6612V	probably damaging	Het
Naip2	T	C	13: 100,161,854	E558G	probably benign	Het
Ncdn	T	C	4: 126,750,040	K330E	probably benign	Het
Neb	C	T	2: 52,183,275	D1975N	possibly damaging	Het
Nell1	T	A	7: 50,853,873	N675K	possibly damaging	Het
Nlrp6	GAGAAGAAGAAGAAGAAGAAGA	GAGAAGAAGAAGAAGAAGA	7: 140,924,113		probably benign	Het
Olfr1317	G	A	2: 112,142,623	R226H	probably benign	Het
Rnf43	A	G	11: 87,734,177	E737G	possibly damaging	Het
Sardh	C	A	2: 27,239,461	W275L	probably damaging	Het
Sel1l2	C	T	2: 140,230,059		probably benign	Het
Sipa1l2	G	A	8: 125,449,973	H1185Y	probably damaging	Het
Spag16	G	A	1: 69,895,280		probably benign	Het
Spink14	A	G	18: 44,028,829		probably benign	Het
Stk4	C	T	2: 164,100,528	T360M	probably benign	Het
Stx12	T	A	4: 132,871,649	I43L	probably benign	Het
Tmc1	T	A	19: 20,816,184	I538F	possibly damaging	Het
Tollip	T	C	7: 141,884,555	M209V	probably benign	Het
Ttn	A	T	2: 76,812,968	S13202R	probably damaging	Het
Vmn2r60	T	A	7: 42,136,787	V338D	probably damaging	Het
Vwa8	T	C	14: 79,026,031	L767P	probably damaging	Het
Zfp202	C	T	9: 40,211,496	T518I	probably damaging	Het

Other mutations in Skp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00841:Skp2	APN	15	9139487	missense	probably benign	0.00
IGL02135:Skp2	APN	15	9125147	missense	probably benign
R0050:Skp2	UTSW	15	9125091	missense	probably benign	0.03
R0129:Skp2	UTSW	15	9125193	missense	probably damaging	1.00
R0238:Skp2	UTSW	15	9127884	critical splice donor site	probably null
R0238:Skp2	UTSW	15	9127884	critical splice donor site	probably null
R1404:Skp2	UTSW	15	9116925	nonsense	probably null
R1503:Skp2	UTSW	15	9127911	missense	probably damaging	1.00
R1660:Skp2	UTSW	15	9125114	missense	probably benign	0.03
R1746:Skp2	UTSW	15	9139443	missense	possibly damaging	0.58
R2031:Skp2	UTSW	15	9113698	missense	probably damaging	1.00
R2034:Skp2	UTSW	15	9113698	missense	probably damaging	1.00
R2087:Skp2	UTSW	15	9113698	missense	probably damaging	1.00
R2088:Skp2	UTSW	15	9113698	missense	probably damaging	1.00
R2090:Skp2	UTSW	15	9113698	missense	probably damaging	1.00
R2091:Skp2	UTSW	15	9113698	missense	probably damaging	1.00
R4272:Skp2	UTSW	15	9116860	critical splice donor site	probably null
R4428:Skp2	UTSW	15	9116947	missense	probably benign	0.21
R4747:Skp2	UTSW	15	9113839	missense	possibly damaging	0.93
R5734:Skp2	UTSW	15	9139479	missense	possibly damaging	0.85
R6963:Skp2	UTSW	15	9139428	splice site	probably null
R7452:Skp2	UTSW	15	9113832	missense	probably damaging	1.00
R7481:Skp2	UTSW	15	9113817	missense	probably damaging	0.97
R7855:Skp2	UTSW	15	9122241	missense	probably benign	0.00
R7989:Skp2	UTSW	15	9127892	missense	probably benign	0.00
R8046:Skp2	UTSW	15	9139600	missense	probably damaging	1.00
R8497:Skp2	UTSW	15	9127884	critical splice donor site	probably null
R9062:Skp2	UTSW	15	9113733	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTGGGCATTTTGTGGCACATC -3'
(R):5'- CGGCAGGAAACTTCTATGTTGGGAC -3'

Sequencing Primer
(F):5'- GGCATTTTGTGGCACATCAATATC -3'
(R):5'- GACCATGACCATGACATCTGTTTG -3'

Posted On

2014-05-09