Mutagenetix > Incidental Mutation

Incidental Mutation 'R1404:Vwa8'

188670

Institutional Source

Beutler Lab

Gene Symbol

Vwa8

Ensembl Gene

ENSMUSG00000058997

Gene Name

von Willebrand factor A domain containing 8

Synonyms

4932416F07Rik, 1300010F03Rik

MMRRC Submission

039466-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1404 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

78849052-79202310 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 79026031 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 767 (L767P)

Ref Sequence

ENSEMBL: ENSMUSP00000154270 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040990] [ENSMUST00000227255]

AlphaFold

Q8CC88

Predicted Effect

probably damaging
Transcript: ENSMUST00000040990
AA Change: L767P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000048925
Gene: ENSMUSG00000058997
AA Change: L767P

Domain	Start	End	E-Value	Type
low complexity region	5	15	N/A	INTRINSIC
low complexity region	20	33	N/A	INTRINSIC
Pfam:AAA_5	104	260	6.3e-44	PFAM
AAA	438	613	4.69e-2	SMART
AAA	772	904	1.26e-1	SMART
low complexity region	1213	1221	N/A	INTRINSIC
low complexity region	1565	1586	N/A	INTRINSIC
VWA	1712	1901	2.71e-10	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000227255
AA Change: L767P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Meta Mutation Damage Score

0.8279

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.1%
20x: 92.0%

Validation Efficiency

100% (28/28)

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca1	G	A	4: 53,059,253		probably benign	Het
Actl6a	T	C	3: 32,722,610		probably benign	Het
Aox2	T	C	1: 58,346,212		probably benign	Het
Arrdc3	A	G	13: 80,883,854	T69A	probably damaging	Het
Bbs2	T	C	8: 94,081,999	K360R	probably null	Het
Cdh8	A	T	8: 99,279,618	N112K	probably damaging	Het
Ces5a	A	T	8: 93,502,181	F474I	probably damaging	Het
Doxl2	A	T	6: 48,975,833	T231S	probably benign	Het
Dync1i1	G	A	6: 5,915,876	D253N	probably damaging	Het
Fam151b	T	C	13: 92,473,972	D103G	probably damaging	Het
Fam227b	A	G	2: 126,003,839	L410P	probably damaging	Het
Ihh	A	T	1: 74,951,213	M1K	probably null	Het
Itga6	A	G	2: 71,838,716	T617A	probably benign	Het
Itpr1	T	A	6: 108,386,648	C744S	probably benign	Het
Kif5a	T	C	10: 127,245,442	I208V	probably benign	Het
Lama4	A	G	10: 39,061,391	K659R	probably benign	Het
Lpin3	T	A	2: 160,892,390		probably null	Het
Macf1	T	A	4: 123,376,516	E6612V	probably damaging	Het
Naip2	T	C	13: 100,161,854	E558G	probably benign	Het
Ncdn	T	C	4: 126,750,040	K330E	probably benign	Het
Neb	C	T	2: 52,183,275	D1975N	possibly damaging	Het
Nell1	T	A	7: 50,853,873	N675K	possibly damaging	Het
Nlrp6	GAGAAGAAGAAGAAGAAGAAGA	GAGAAGAAGAAGAAGAAGA	7: 140,924,113		probably benign	Het
Olfr1317	G	A	2: 112,142,623	R226H	probably benign	Het
Rnf43	A	G	11: 87,734,177	E737G	possibly damaging	Het
Sardh	C	A	2: 27,239,461	W275L	probably damaging	Het
Sel1l2	C	T	2: 140,230,059		probably benign	Het
Sipa1l2	G	A	8: 125,449,973	H1185Y	probably damaging	Het
Skp2	G	A	15: 9,116,925	Q298*	probably null	Het
Spag16	G	A	1: 69,895,280		probably benign	Het
Spink14	A	G	18: 44,028,829		probably benign	Het
Stk4	C	T	2: 164,100,528	T360M	probably benign	Het
Stx12	T	A	4: 132,871,649	I43L	probably benign	Het
Tmc1	T	A	19: 20,816,184	I538F	possibly damaging	Het
Tollip	T	C	7: 141,884,555	M209V	probably benign	Het
Ttn	A	T	2: 76,812,968	S13202R	probably damaging	Het
Vmn2r60	T	A	7: 42,136,787	V338D	probably damaging	Het
Zfp202	C	T	9: 40,211,496	T518I	probably damaging	Het

Other mutations in Vwa8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00589:Vwa8	APN	14	79038195	missense	probably damaging	1.00
IGL01087:Vwa8	APN	14	78935229	missense	probably benign	0.16
IGL01137:Vwa8	APN	14	79103647	missense	probably damaging	1.00
IGL01359:Vwa8	APN	14	79064913	nonsense	probably null
IGL01449:Vwa8	APN	14	79182988	nonsense	probably null
IGL01604:Vwa8	APN	14	79180804	missense	possibly damaging	0.82
IGL01636:Vwa8	APN	14	79198354	missense	possibly damaging	0.68
IGL01815:Vwa8	APN	14	79198277	missense	possibly damaging	0.92
IGL02024:Vwa8	APN	14	79094284	missense	possibly damaging	0.91
IGL02033:Vwa8	APN	14	78984209	missense	possibly damaging	0.89
IGL02154:Vwa8	APN	14	78849293	missense	possibly damaging	0.53
IGL02286:Vwa8	APN	14	78947273	critical splice donor site	probably null
IGL02393:Vwa8	APN	14	79182977	missense	probably damaging	1.00
IGL02430:Vwa8	APN	14	78934645	critical splice donor site	probably null
IGL02476:Vwa8	APN	14	78925341	missense	possibly damaging	0.62
IGL02612:Vwa8	APN	14	79183112	missense	probably benign	0.01
IGL02678:Vwa8	APN	14	78984200	missense	probably damaging	0.99
IGL02797:Vwa8	APN	14	78925262	missense	probably benign	0.29
IGL02806:Vwa8	APN	14	79157088	missense	probably benign	0.35
IGL02811:Vwa8	APN	14	78994459	missense	probably benign	0.21
IGL02892:Vwa8	APN	14	79103700	splice site	probably benign
IGL03024:Vwa8	APN	14	78995098	missense	probably benign	0.03
IGL03075:Vwa8	APN	14	78933756	missense	probably damaging	0.99
IGL03090:Vwa8	APN	14	78934601	missense	possibly damaging	0.92
IGL03124:Vwa8	APN	14	79058815	splice site	probably benign
IGL03181:Vwa8	APN	14	79009250	missense	probably benign	0.01
IGL03296:Vwa8	APN	14	79183100	missense	probably damaging	0.98
IGL03376:Vwa8	APN	14	79183134	splice site	probably null
R6812_Vwa8_870	UTSW	14	79197419	missense	probably damaging	0.99
IGL03052:Vwa8	UTSW	14	79064921	missense	probably benign	0.02
PIT4468001:Vwa8	UTSW	14	79183061	missense	probably damaging	1.00
R0049:Vwa8	UTSW	14	79093739	missense	probably benign	0.21
R0063:Vwa8	UTSW	14	79164216	splice site	probably benign
R0063:Vwa8	UTSW	14	79164216	splice site	probably benign
R0081:Vwa8	UTSW	14	79082782	missense	probably benign	0.02
R0305:Vwa8	UTSW	14	79009273	missense	probably damaging	1.00
R0433:Vwa8	UTSW	14	79062676	missense	probably damaging	1.00
R0514:Vwa8	UTSW	14	78947189	missense	probably benign
R0602:Vwa8	UTSW	14	79020620	missense	probably benign	0.00
R0615:Vwa8	UTSW	14	78908150	missense	probably benign
R0791:Vwa8	UTSW	14	78994576	splice site	probably benign
R1028:Vwa8	UTSW	14	78908230	missense	probably damaging	1.00
R1037:Vwa8	UTSW	14	79086654	nonsense	probably null
R1404:Vwa8	UTSW	14	79026031	missense	probably damaging	1.00
R1412:Vwa8	UTSW	14	78908230	missense	probably damaging	1.00
R1421:Vwa8	UTSW	14	78908230	missense	probably damaging	1.00
R1467:Vwa8	UTSW	14	79103694	nonsense	probably null
R1467:Vwa8	UTSW	14	79103694	nonsense	probably null
R1539:Vwa8	UTSW	14	79062562	missense	probably benign	0.00
R1556:Vwa8	UTSW	14	79086681	missense	probably benign
R1589:Vwa8	UTSW	14	78908230	missense	probably damaging	1.00
R1590:Vwa8	UTSW	14	78908230	missense	probably damaging	1.00
R1591:Vwa8	UTSW	14	78908230	missense	probably damaging	1.00
R1645:Vwa8	UTSW	14	79182987	missense	probably damaging	1.00
R1673:Vwa8	UTSW	14	78908230	missense	probably damaging	1.00
R1688:Vwa8	UTSW	14	79201103	missense	possibly damaging	0.72
R1764:Vwa8	UTSW	14	78908195	missense	probably damaging	1.00
R1830:Vwa8	UTSW	14	79081136	missense	probably benign	0.04
R1926:Vwa8	UTSW	14	79020635	missense	probably benign	0.00
R1959:Vwa8	UTSW	14	78982360	missense	possibly damaging	0.95
R1971:Vwa8	UTSW	14	78925254	splice site	probably benign
R2078:Vwa8	UTSW	14	78908157	missense	probably damaging	1.00
R2103:Vwa8	UTSW	14	78908230	missense	probably damaging	1.00
R2230:Vwa8	UTSW	14	79092403	critical splice donor site	probably null
R2281:Vwa8	UTSW	14	79064996	missense	possibly damaging	0.91
R2313:Vwa8	UTSW	14	78912218	missense	probably damaging	0.98
R2847:Vwa8	UTSW	14	78947142	missense	probably benign	0.00
R2848:Vwa8	UTSW	14	78947142	missense	probably benign	0.00
R2894:Vwa8	UTSW	14	79038138	missense	probably damaging	1.00
R2991:Vwa8	UTSW	14	78995149	missense	probably benign	0.00
R3077:Vwa8	UTSW	14	79098342	missense	probably benign	0.03
R3405:Vwa8	UTSW	14	79164220	splice site	probably benign
R3406:Vwa8	UTSW	14	79164220	splice site	probably benign
R3708:Vwa8	UTSW	14	79062696	splice site	probably benign
R3779:Vwa8	UTSW	14	79102322	splice site	probably benign
R3799:Vwa8	UTSW	14	79064896	missense	probably damaging	0.99
R4230:Vwa8	UTSW	14	79082852	missense	probably benign	0.00
R4425:Vwa8	UTSW	14	79082806	missense	probably benign	0.00
R4478:Vwa8	UTSW	14	78868801	missense	probably benign	0.00
R4627:Vwa8	UTSW	14	79103697	critical splice donor site	probably null
R4835:Vwa8	UTSW	14	78934613	missense	probably benign	0.11
R4868:Vwa8	UTSW	14	79183082	missense	probably damaging	1.00
R4988:Vwa8	UTSW	14	79198283	missense	probably benign	0.05
R5137:Vwa8	UTSW	14	79064902	missense	probably damaging	1.00
R5156:Vwa8	UTSW	14	78984226	missense	probably benign	0.00
R5658:Vwa8	UTSW	14	78982398	critical splice donor site	probably null
R5841:Vwa8	UTSW	14	78994518	missense	probably benign
R6057:Vwa8	UTSW	14	79082873	missense	probably benign	0.21
R6244:Vwa8	UTSW	14	79086662	missense	probably benign
R6264:Vwa8	UTSW	14	79086812	missense	possibly damaging	0.64
R6290:Vwa8	UTSW	14	79094332	splice site	probably null
R6332:Vwa8	UTSW	14	79197464	missense	probably benign
R6395:Vwa8	UTSW	14	79093744	missense	probably benign	0.02
R6472:Vwa8	UTSW	14	79009170	missense	possibly damaging	0.71
R6497:Vwa8	UTSW	14	79096401	missense	probably benign	0.00
R6527:Vwa8	UTSW	14	78947213	missense	possibly damaging	0.73
R6552:Vwa8	UTSW	14	79198222	missense	possibly damaging	0.80
R6812:Vwa8	UTSW	14	79197419	missense	probably damaging	0.99
R6994:Vwa8	UTSW	14	78908156	missense	possibly damaging	0.90
R7040:Vwa8	UTSW	14	78912205	missense	probably damaging	1.00
R7357:Vwa8	UTSW	14	79038201	missense	probably null	1.00
R7363:Vwa8	UTSW	14	79018707	missense	probably benign	0.05
R7381:Vwa8	UTSW	14	79095685	missense	probably benign	0.00
R7406:Vwa8	UTSW	14	78982234	critical splice acceptor site	probably null
R7408:Vwa8	UTSW	14	78982234	critical splice acceptor site	probably null
R7409:Vwa8	UTSW	14	78982234	critical splice acceptor site	probably null
R7410:Vwa8	UTSW	14	78982234	critical splice acceptor site	probably null
R7483:Vwa8	UTSW	14	78982234	critical splice acceptor site	probably null
R7484:Vwa8	UTSW	14	78982234	critical splice acceptor site	probably null
R7491:Vwa8	UTSW	14	79082814	missense	probably benign	0.24
R7500:Vwa8	UTSW	14	78925246	splice site	probably null
R7514:Vwa8	UTSW	14	78982234	critical splice acceptor site	probably null
R7582:Vwa8	UTSW	14	78982234	critical splice acceptor site	probably null
R7584:Vwa8	UTSW	14	78982234	critical splice acceptor site	probably null
R7585:Vwa8	UTSW	14	78982234	critical splice acceptor site	probably null
R7647:Vwa8	UTSW	14	78935229	missense	probably damaging	0.99
R7685:Vwa8	UTSW	14	79098300	missense	probably benign
R7703:Vwa8	UTSW	14	79026073	missense	probably damaging	1.00
R7730:Vwa8	UTSW	14	78995149	missense	probably benign	0.00
R7775:Vwa8	UTSW	14	79038147	missense	probably benign	0.03
R7778:Vwa8	UTSW	14	79038147	missense	probably benign	0.03
R7824:Vwa8	UTSW	14	79038147	missense	probably benign	0.03
R7885:Vwa8	UTSW	14	79020649	missense	probably benign	0.00
R7902:Vwa8	UTSW	14	79092291	missense	probably benign	0.00
R8262:Vwa8	UTSW	14	78933832	critical splice donor site	probably null
R8458:Vwa8	UTSW	14	79064892	missense	probably damaging	1.00
R8495:Vwa8	UTSW	14	78937177	nonsense	probably null
R8557:Vwa8	UTSW	14	79009209	missense	probably damaging	1.00
R8841:Vwa8	UTSW	14	78947262	missense	probably benign	0.04
R8906:Vwa8	UTSW	14	79092375	missense	probably benign	0.00
R8947:Vwa8	UTSW	14	79201112	missense	probably damaging	1.00
R9034:Vwa8	UTSW	14	79058739	missense	probably damaging	1.00
R9051:Vwa8	UTSW	14	79086710	missense	probably benign	0.00
R9179:Vwa8	UTSW	14	79098361	missense	probably benign
R9433:Vwa8	UTSW	14	79098431	critical splice donor site	probably null
R9455:Vwa8	UTSW	14	79062675	missense	probably damaging	1.00
R9496:Vwa8	UTSW	14	79020682	missense	probably benign
R9530:Vwa8	UTSW	14	78935199	missense	probably benign	0.33
R9584:Vwa8	UTSW	14	79157109	missense	probably benign
R9763:Vwa8	UTSW	14	78949548	missense	probably damaging	1.00
Z1088:Vwa8	UTSW	14	78982246	missense	probably benign	0.38
Z1177:Vwa8	UTSW	14	79058692	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCTCACATGAGCTATTTGAAGTTGTCA -3'
(R):5'- GGTGGGGAACACCTTGAATCTTGG -3'

Sequencing Primer
(F):5'- aggtaggcagaggcagg -3'
(R):5'- AGATCCCTGTTTTGATGGTAAAGAG -3'

Posted On

2014-05-09