Incidental Mutation 'R1852:4930433I11Rik'
ID208211
Institutional Source Beutler Lab
Gene Symbol 4930433I11Rik
Ensembl Gene ENSMUSG00000091692
Gene NameRIKEN cDNA 4930433I11 gene
SynonymsLOC243944
MMRRC Submission 039876-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R1852 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location40987543-40995435 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 40993613 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 326 (D326E)
Ref Sequence ENSEMBL: ENSMUSP00000146117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171664] [ENSMUST00000206529]
Predicted Effect probably benign
Transcript: ENSMUST00000171664
AA Change: D235E

PolyPhen 2 Score 0.170 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000131120
Gene: ENSMUSG00000091692
AA Change: D235E

DomainStartEndE-ValueType
Pfam:DUF4629 208 354 2.2e-60 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206360
Predicted Effect probably benign
Transcript: ENSMUST00000206529
AA Change: D326E

PolyPhen 2 Score 0.293 (Sensitivity: 0.91; Specificity: 0.89)
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A G 11: 78,268,473 D499G probably damaging Het
2900092C05Rik A G 7: 12,512,702 probably null Het
A530032D15Rik G A 1: 85,085,131 probably benign Het
Abca8a T C 11: 110,069,386 D676G probably damaging Het
Abcb7 T C X: 104,305,399 M153V probably benign Het
Ablim3 G A 18: 61,849,395 H160Y probably benign Het
Acsl6 T C 11: 54,361,076 I683T probably damaging Het
Adgrg5 A T 8: 94,937,800 Y345F probably damaging Het
Alg6 T G 4: 99,746,362 F114V probably benign Het
Ank2 A C 3: 126,997,851 probably null Het
Ankrd24 A T 10: 81,642,941 probably benign Het
Ano8 T C 8: 71,483,487 K222E probably damaging Het
Arhgef5 T C 6: 43,275,185 S957P probably benign Het
Bmpr1b A T 3: 141,857,402 probably null Het
C3 A G 17: 57,222,823 V2A probably damaging Het
Capn1 A G 19: 6,009,103 V276A possibly damaging Het
Ccdc57 T C 11: 120,921,673 E85G probably damaging Het
Chil3 C T 3: 106,148,801 probably null Het
Chl1 A T 6: 103,699,159 probably null Het
Chodl C T 16: 78,941,258 P38L probably benign Het
Clec4a2 G T 6: 123,139,125 E124* probably null Het
Cmtr1 T C 17: 29,702,255 V825A probably benign Het
Cnksr3 T C 10: 7,120,539 I232V probably benign Het
Cntn1 C T 15: 92,305,140 R768C probably damaging Het
Col15a1 G T 4: 47,299,278 probably null Het
Col6a3 T A 1: 90,807,534 I798F possibly damaging Het
Cpxcr1 T A X: 116,478,061 L223* probably null Het
Cul1 A G 6: 47,520,830 N615S probably damaging Het
Cxcr2 A G 1: 74,159,279 I311V probably benign Het
Cyp2c67 C T 19: 39,617,367 G362S probably benign Het
D930048N14Rik T A 11: 51,653,865 probably benign Het
Ddx49 T C 8: 70,300,983 T79A probably damaging Het
Defb46 T A 8: 19,239,975 probably null Het
Dnah17 T A 11: 118,121,916 I145F probably damaging Het
Dock8 A T 19: 25,127,128 I725F probably benign Het
Dppa4 G A 16: 48,287,884 A11T probably damaging Het
Enam T A 5: 88,504,465 S1278T possibly damaging Het
Fndc3a A G 14: 72,556,843 V829A probably damaging Het
Gatb T G 3: 85,618,877 L354R probably damaging Het
Gm10787 A T 10: 77,021,877 noncoding transcript Het
Gm13084 T C 4: 143,812,826 I32M probably benign Het
Gsap T A 5: 21,290,545 probably null Het
Gtf2ird1 T C 5: 134,382,580 probably null Het
Has3 A T 8: 106,874,079 I58F probably damaging Het
Haus5 A T 7: 30,658,501 probably null Het
Hip1r T C 5: 123,991,505 V169A probably benign Het
Hnf1a T A 5: 114,970,711 D45V probably damaging Het
Il20ra T A 10: 19,743,019 Y72N probably damaging Het
Ipo11 A T 13: 106,812,257 V914E possibly damaging Het
Itpr1 T C 6: 108,386,706 L763P probably damaging Het
Katnal2 C A 18: 77,016,023 R104L probably benign Het
Kcng4 G T 8: 119,626,208 P321Q probably benign Het
Larp4b T C 13: 9,137,303 probably null Het
Lars T C 18: 42,212,608 N1001S probably benign Het
Lhcgr T A 17: 88,765,176 I148F probably damaging Het
Lsm10 T A 4: 126,097,963 S37R possibly damaging Het
Mfsd13a A G 19: 46,372,180 probably null Het
Mipep T A 14: 60,843,240 C560* probably null Het
Mme A G 3: 63,327,983 S97G probably benign Het
Mme G A 3: 63,328,046 D172N probably benign Het
Mx1 A T 16: 97,448,203 L608Q probably damaging Het
Myt1l T C 12: 29,851,661 M208T probably benign Het
Neb T C 2: 52,228,542 I3987V probably damaging Het
Nelfcd A G 2: 174,423,978 probably null Het
Neto1 T C 18: 86,395,884 M1T probably null Het
Nom1 T C 5: 29,446,878 F738S possibly damaging Het
Olfr1137 T C 2: 87,710,973 probably null Het
Olfr1160 T G 2: 88,006,521 I86L probably damaging Het
Olfr1314 C A 2: 112,091,847 V285L probably benign Het
Olfr1420 C A 19: 11,896,885 P288H probably damaging Het
Olfr1487 C T 19: 13,619,603 S147F probably damaging Het
Olfr523 T A 7: 140,176,561 L147* probably null Het
Olfr572 C T 7: 102,928,441 S271L probably damaging Het
Olfr772 T C 10: 129,174,328 K231R probably benign Het
Pak1ip1 A G 13: 41,011,232 T264A possibly damaging Het
Palb2 G T 7: 122,114,314 D915E possibly damaging Het
Pank4 T C 4: 154,976,359 L491P probably damaging Het
Paqr7 T C 4: 134,507,669 V279A probably benign Het
Pcif1 G A 2: 164,888,466 R373Q probably damaging Het
Pdgfa T A 5: 138,979,172 N185I probably benign Het
Plcd4 T C 1: 74,549,361 V123A possibly damaging Het
Prune2 A G 19: 17,199,139 I154V probably damaging Het
Rac3 T G 11: 120,723,494 L148R possibly damaging Het
Rapgef6 T A 11: 54,642,811 D362E probably benign Het
Rbl1 A G 2: 157,174,903 I592T probably benign Het
Rbl2 A C 8: 91,095,563 D408A possibly damaging Het
Retreg2 A G 1: 75,146,675 K416E probably benign Het
Rorb A T 19: 18,962,083 L234H probably damaging Het
Rpp40 T G 13: 35,896,914 D279A probably benign Het
Siglec1 C A 2: 131,081,500 V442L probably damaging Het
Sik3 C G 9: 46,221,089 H1276Q probably benign Het
Skiv2l2 A T 13: 112,872,927 H979Q probably benign Het
Slc25a34 G A 4: 141,622,268 T192I probably benign Het
Sptbn5 T C 2: 120,071,644 I126M possibly damaging Het
Strada A G 11: 106,171,221 V94A possibly damaging Het
Stxbp5 C A 10: 9,812,298 V420F possibly damaging Het
Tcrg-C3 A T 13: 19,261,091 M70L probably damaging Het
Tgm1 T C 14: 55,704,941 Y651C probably damaging Het
Tmem200c T A 17: 68,840,617 V65E probably damaging Het
Tmem74 A T 15: 43,867,163 D161E probably benign Het
Vcan T G 13: 89,705,392 E483A probably damaging Het
Vmn2r124 A G 17: 18,063,174 T377A probably benign Het
Vmn2r3 A C 3: 64,259,394 I772S probably damaging Het
Wdfy3 A G 5: 101,915,376 V1342A probably benign Het
Zfp507 T C 7: 35,787,751 H764R probably damaging Het
Znrf3 A G 11: 5,287,455 I218T possibly damaging Het
Other mutations in 4930433I11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02380:4930433I11Rik APN 7 40994544 missense possibly damaging 0.50
FR4304:4930433I11Rik UTSW 7 40993056 small deletion probably benign
FR4340:4930433I11Rik UTSW 7 40993055 small deletion probably benign
FR4342:4930433I11Rik UTSW 7 40993055 small deletion probably benign
FR4548:4930433I11Rik UTSW 7 40993056 small deletion probably benign
R0498:4930433I11Rik UTSW 7 40993294 missense probably benign 0.11
R0610:4930433I11Rik UTSW 7 40993056 missense probably benign 0.22
R0704:4930433I11Rik UTSW 7 40993957 missense probably damaging 1.00
R0723:4930433I11Rik UTSW 7 40993056 missense probably benign 0.22
R0826:4930433I11Rik UTSW 7 40993056 missense probably benign 0.22
R0850:4930433I11Rik UTSW 7 40993056 missense probably benign 0.22
R0862:4930433I11Rik UTSW 7 40993056 missense probably benign 0.22
R0863:4930433I11Rik UTSW 7 40993056 missense probably benign 0.22
R0960:4930433I11Rik UTSW 7 40993056 missense probably benign 0.22
R0961:4930433I11Rik UTSW 7 40993056 missense probably benign 0.22
R0964:4930433I11Rik UTSW 7 40993056 missense probably benign 0.22
R1099:4930433I11Rik UTSW 7 40993056 missense probably benign 0.22
R1101:4930433I11Rik UTSW 7 40993056 missense probably benign 0.22
R1167:4930433I11Rik UTSW 7 40993579 missense probably damaging 1.00
R1401:4930433I11Rik UTSW 7 40993056 missense probably benign 0.22
R1429:4930433I11Rik UTSW 7 40993056 missense probably benign 0.22
R1462:4930433I11Rik UTSW 7 40992946 nonsense probably null
R1462:4930433I11Rik UTSW 7 40992946 nonsense probably null
R1816:4930433I11Rik UTSW 7 40994798 nonsense probably null
R3814:4930433I11Rik UTSW 7 40992919 missense probably damaging 0.99
R4124:4930433I11Rik UTSW 7 40993921 missense probably damaging 1.00
R4823:4930433I11Rik UTSW 7 40993362 missense probably benign 0.00
R5092:4930433I11Rik UTSW 7 40987667 start gained probably benign
R5792:4930433I11Rik UTSW 7 40993521 missense possibly damaging 0.76
R6160:4930433I11Rik UTSW 7 40993526 missense possibly damaging 0.91
R6300:4930433I11Rik UTSW 7 40993461 missense possibly damaging 0.91
R6349:4930433I11Rik UTSW 7 40994772 missense possibly damaging 0.89
R6755:4930433I11Rik UTSW 7 40994310 missense probably damaging 1.00
R6995:4930433I11Rik UTSW 7 40994725 missense probably benign 0.00
R7156:4930433I11Rik UTSW 7 40993858 missense possibly damaging 0.54
R7232:4930433I11Rik UTSW 7 40993179 missense probably damaging 1.00
R7318:4930433I11Rik UTSW 7 40993687 missense probably benign 0.04
RF003:4930433I11Rik UTSW 7 40993055 small deletion probably benign
RF004:4930433I11Rik UTSW 7 40993055 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TCAAATTCCTCACAGGCCTAG -3'
(R):5'- AAGCTGCTGTGGCTAAGCTC -3'

Sequencing Primer
(F):5'- TTCCTCACAGGCCTAGATCAATAC -3'
(R):5'- TGGCTAAGCTCAGGTAGATCC -3'
Posted On2014-06-23