Incidental Mutation 'R1915:Kcnh6'
ID214791
Institutional Source Beutler Lab
Gene Symbol Kcnh6
Ensembl Gene ENSMUSG00000001901
Gene Namepotassium voltage-gated channel, subfamily H (eag-related), member 6
Synonymsm-erg2
MMRRC Submission 039933-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1915 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location106008124-106034549 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 106017444 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 295 (Y295*)
Ref Sequence ENSEMBL: ENSMUSP00000137675 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001965] [ENSMUST00000106903] [ENSMUST00000145539]
Predicted Effect probably null
Transcript: ENSMUST00000001965
AA Change: Y295*
SMART Domains Protein: ENSMUSP00000001965
Gene: ENSMUSG00000001901
AA Change: Y295*

DomainStartEndE-ValueType
Blast:PAS 13 87 2e-43 BLAST
PAC 93 135 4.06e-2 SMART
low complexity region 139 152 N/A INTRINSIC
low complexity region 158 173 N/A INTRINSIC
Pfam:Ion_trans 256 523 6.8e-40 PFAM
Pfam:Ion_trans_2 445 517 2.6e-13 PFAM
cNMP 594 712 3.21e-23 SMART
coiled coil region 782 809 N/A INTRINSIC
low complexity region 901 912 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106903
AA Change: Y295*
SMART Domains Protein: ENSMUSP00000102516
Gene: ENSMUSG00000001901
AA Change: Y295*

DomainStartEndE-ValueType
Blast:PAS 13 87 3e-43 BLAST
PAC 93 135 4.06e-2 SMART
low complexity region 139 152 N/A INTRINSIC
low complexity region 158 173 N/A INTRINSIC
transmembrane domain 258 280 N/A INTRINSIC
Pfam:Ion_trans 302 420 6.2e-10 PFAM
Pfam:Ion_trans_2 395 464 2.6e-9 PFAM
cNMP 541 659 3.21e-23 SMART
coiled coil region 729 756 N/A INTRINSIC
low complexity region 848 859 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140695
Predicted Effect probably null
Transcript: ENSMUST00000145539
AA Change: Y295*
SMART Domains Protein: ENSMUSP00000137675
Gene: ENSMUSG00000001901
AA Change: Y295*

DomainStartEndE-ValueType
Blast:PAS 13 87 3e-43 BLAST
PAC 93 135 4.06e-2 SMART
low complexity region 139 152 N/A INTRINSIC
low complexity region 158 173 N/A INTRINSIC
transmembrane domain 261 283 N/A INTRINSIC
Pfam:Ion_trans 302 511 1.4e-22 PFAM
Pfam:Ion_trans_2 442 517 2e-13 PFAM
cNMP 594 712 3.21e-23 SMART
low complexity region 764 775 N/A INTRINSIC
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.4%
Validation Efficiency 100% (85/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit. Alternative splicing results in multiple transcript variants that encode different isoforms. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,212,210 R852G probably benign Het
Adam2 C A 14: 66,037,557 V576F possibly damaging Het
Afmid T C 11: 117,835,799 F250L possibly damaging Het
Apc2 A T 10: 80,315,867 I2252L probably benign Het
Bcar1 A G 8: 111,715,398 V270A probably damaging Het
Btnl7-ps T A 17: 34,541,645 noncoding transcript Het
Cdkn2aip T C 8: 47,711,926 T251A probably benign Het
Cdx1 A G 18: 61,019,898 V212A probably benign Het
Cep95 C T 11: 106,814,638 T483I probably damaging Het
Cfap100 T C 6: 90,412,347 probably benign Het
Cfap54 A G 10: 92,884,702 V2630A unknown Het
Chia1 T A 3: 106,128,559 N238K probably benign Het
Cldn23 T A 8: 35,825,945 I130F possibly damaging Het
Cntrl T C 2: 35,162,861 M1126T probably benign Het
Col28a1 A G 6: 8,176,333 F8S probably benign Het
Cpeb3 C T 19: 37,054,265 R579Q probably damaging Het
Creld2 G A 15: 88,820,631 W103* probably null Het
Dbh A G 2: 27,168,222 D134G probably damaging Het
Dcbld1 G T 10: 52,317,035 C292F probably damaging Het
Dlgap5 T C 14: 47,407,773 K304E probably benign Het
Dnajc2 A G 5: 21,781,319 probably null Het
Eps8l2 G A 7: 141,361,852 V650M probably damaging Het
Erlin1 T C 19: 44,059,065 Y139C probably damaging Het
Exoc3 A G 13: 74,173,294 probably null Het
F5 C A 1: 164,182,917 R406S probably damaging Het
Fahd1 A T 17: 24,849,648 W152R possibly damaging Het
Farp2 T A 1: 93,528,702 S36T probably benign Het
Foxs1 A G 2: 152,932,840 C98R probably damaging Het
Gal3st4 T A 5: 138,265,410 K442N probably benign Het
Gm10644 G A 8: 83,933,850 probably benign Het
Gm8674 A T 13: 49,900,853 noncoding transcript Het
Gpr88 G T 3: 116,252,424 S79R possibly damaging Het
Heatr9 T G 11: 83,518,209 I171L possibly damaging Het
Hectd4 A G 5: 121,322,294 T2209A probably benign Het
Hsh2d A G 8: 72,193,521 T21A probably damaging Het
Irf4 A T 13: 30,761,462 Q397L probably benign Het
Itgae T A 11: 73,118,643 probably benign Het
Jrkl A T 9: 13,245,604 D17E possibly damaging Het
Kcna4 T C 2: 107,296,778 V619A probably benign Het
Kif1b G A 4: 149,267,216 T263I probably damaging Het
Large2 G T 2: 92,365,825 probably benign Het
Lcp1 T A 14: 75,199,297 Y28N possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mccc2 T C 13: 99,948,530 probably null Het
Mlh3 T C 12: 85,261,668 Y1115C probably benign Het
Mlst8 C T 17: 24,477,290 W155* probably null Het
Myh10 T C 11: 68,790,208 L1025P probably damaging Het
Myof T A 19: 37,977,693 N393I probably damaging Het
Nalcn C T 14: 123,302,769 V1140I probably benign Het
Ncald C T 15: 37,397,080 A119T probably benign Het
Nipbl T C 15: 8,343,630 E1044G possibly damaging Het
Nupl1 T C 14: 60,238,531 K279R probably benign Het
Oas1a A T 5: 120,905,813 N85K possibly damaging Het
Olfr1076 A G 2: 86,508,999 D180G probably damaging Het
Olfr738 C T 14: 50,414,341 P266S probably damaging Het
Olfr870 T C 9: 20,171,028 Y181C probably benign Het
Pou2f2 C T 7: 25,100,156 A92T possibly damaging Het
Ppp1r16a T C 15: 76,693,068 L212P probably damaging Het
Pram1 A T 17: 33,641,157 I233F probably benign Het
Ptbp3 A T 4: 59,517,635 L84Q probably damaging Het
Ptgr2 A T 12: 84,302,322 Q145L probably benign Het
Ptpn23 A T 9: 110,386,507 D1396E probably damaging Het
Pudp T C 18: 50,568,207 N152D probably benign Het
Rbm20 T A 19: 53,864,087 L1166Q probably damaging Het
Rictor T G 15: 6,759,572 I223R probably damaging Het
Ripor1 A T 8: 105,616,886 E270D probably damaging Het
Rorc T C 3: 94,391,173 C322R probably damaging Het
Rpgrip1l T C 8: 91,232,924 D1116G probably benign Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Sptan1 C G 2: 30,011,036 Q1425E probably benign Het
Srd5a3 G A 5: 76,147,705 V81I probably benign Het
Stk36 T A 1: 74,634,187 S1080T probably benign Het
Sugp2 T A 8: 70,253,660 I790K probably damaging Het
Syde2 T G 3: 146,014,316 Y764* probably null Het
Tmem130 A G 5: 144,737,856 F353S probably damaging Het
Tmem131 T A 1: 36,796,266 K1591N probably damaging Het
Urb2 C A 8: 124,029,798 T748K possibly damaging Het
Uri1 A T 7: 37,961,678 I480K probably damaging Het
Zcchc3 A C 2: 152,413,681 V366G probably benign Het
Zfp292 G A 4: 34,805,100 S2648F possibly damaging Het
Zfp54 T C 17: 21,434,152 Y303H probably benign Het
Zfp729b A G 13: 67,593,220 F319L probably damaging Het
Zfp934 G A 13: 62,517,955 H291Y probably damaging Het
Other mutations in Kcnh6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Kcnh6 APN 11 106019019 missense probably damaging 1.00
IGL01349:Kcnh6 APN 11 106023917 missense possibly damaging 0.82
IGL01529:Kcnh6 APN 11 106020696 missense probably benign 0.07
IGL01555:Kcnh6 APN 11 106017619 missense probably damaging 0.99
IGL01596:Kcnh6 APN 11 106026746 missense probably benign 0.02
IGL01808:Kcnh6 APN 11 106023927 splice site probably benign
IGL02001:Kcnh6 APN 11 106027549 splice site probably benign
IGL02131:Kcnh6 APN 11 106020175 missense probably damaging 1.00
IGL02254:Kcnh6 APN 11 106020707 missense probably damaging 1.00
IGL02413:Kcnh6 APN 11 106027634 missense possibly damaging 0.77
R0089:Kcnh6 UTSW 11 106009022 missense probably benign 0.31
R1914:Kcnh6 UTSW 11 106017444 nonsense probably null
R2265:Kcnh6 UTSW 11 106033817 missense probably benign
R2325:Kcnh6 UTSW 11 106033835 missense probably benign 0.00
R4449:Kcnh6 UTSW 11 106018936 missense probably damaging 0.99
R4548:Kcnh6 UTSW 11 106009049 missense probably damaging 1.00
R5095:Kcnh6 UTSW 11 106017254 missense possibly damaging 0.92
R5166:Kcnh6 UTSW 11 106020319 missense possibly damaging 0.67
R5358:Kcnh6 UTSW 11 106027591 missense possibly damaging 0.93
R5445:Kcnh6 UTSW 11 106023859 missense probably damaging 1.00
R5652:Kcnh6 UTSW 11 106008985 missense probably damaging 1.00
R5708:Kcnh6 UTSW 11 106020256 missense probably benign 0.04
R5742:Kcnh6 UTSW 11 106009142 missense probably benign 0.32
R6035:Kcnh6 UTSW 11 106019152 critical splice donor site probably null
R6035:Kcnh6 UTSW 11 106019152 critical splice donor site probably null
R6150:Kcnh6 UTSW 11 106020731 missense possibly damaging 0.83
R6827:Kcnh6 UTSW 11 106009099 missense probably benign 0.05
R7172:Kcnh6 UTSW 11 106020274 missense possibly damaging 0.86
R7329:Kcnh6 UTSW 11 106017377 missense probably benign 0.29
R7359:Kcnh6 UTSW 11 106018963 missense possibly damaging 0.46
R7542:Kcnh6 UTSW 11 106014561 missense possibly damaging 0.68
R7571:Kcnh6 UTSW 11 106017416 missense probably benign 0.01
R7580:Kcnh6 UTSW 11 106017548 missense probably damaging 1.00
R7703:Kcnh6 UTSW 11 106023877 missense probably benign
R7726:Kcnh6 UTSW 11 106017575 missense probably benign 0.04
R7837:Kcnh6 UTSW 11 106033810 missense probably benign 0.04
R7854:Kcnh6 UTSW 11 106017346 missense probably damaging 1.00
R8218:Kcnh6 UTSW 11 106017374 missense possibly damaging 0.88
R8274:Kcnh6 UTSW 11 106020161 missense probably damaging 1.00
X0065:Kcnh6 UTSW 11 106025795 missense probably benign
Z1088:Kcnh6 UTSW 11 106009048 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGACCGGTCTTCCTAGCAG -3'
(R):5'- GCCACCATGTCAATGAGGAACC -3'

Sequencing Primer
(F):5'- TGCTGCCAGAGTACAAGCTG -3'
(R):5'- TGTCAATGAGGAACCAGCCCTTG -3'
Posted On2014-07-14