Incidental Mutation 'R1915:Exoc3'
ID214801
Institutional Source Beutler Lab
Gene Symbol Exoc3
Ensembl Gene ENSMUSG00000034152
Gene Nameexocyst complex component 3
SynonymsSec6l1, E430013E20Rik, 2810050O03Rik
MMRRC Submission 039933-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R1915 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location74169488-74208732 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 74173294 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000039416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035934] [ENSMUST00000221703]
Predicted Effect probably null
Transcript: ENSMUST00000035934
SMART Domains Protein: ENSMUSP00000039416
Gene: ENSMUSG00000034152

DomainStartEndE-ValueType
Pfam:Sec6 187 743 1.7e-162 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220679
Predicted Effect probably benign
Transcript: ENSMUST00000221703
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222248
Meta Mutation Damage Score 0.9494 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.4%
Validation Efficiency 100% (85/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multiple protein complex essential for targeting exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and functions of exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. The complex is also essential for the biogenesis of epithelial cell surface polarity. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,212,210 R852G probably benign Het
Adam2 C A 14: 66,037,557 V576F possibly damaging Het
Afmid T C 11: 117,835,799 F250L possibly damaging Het
Apc2 A T 10: 80,315,867 I2252L probably benign Het
Bcar1 A G 8: 111,715,398 V270A probably damaging Het
Btnl7-ps T A 17: 34,541,645 noncoding transcript Het
Cdkn2aip T C 8: 47,711,926 T251A probably benign Het
Cdx1 A G 18: 61,019,898 V212A probably benign Het
Cep95 C T 11: 106,814,638 T483I probably damaging Het
Cfap100 T C 6: 90,412,347 probably benign Het
Cfap54 A G 10: 92,884,702 V2630A unknown Het
Chia1 T A 3: 106,128,559 N238K probably benign Het
Cldn23 T A 8: 35,825,945 I130F possibly damaging Het
Cntrl T C 2: 35,162,861 M1126T probably benign Het
Col28a1 A G 6: 8,176,333 F8S probably benign Het
Cpeb3 C T 19: 37,054,265 R579Q probably damaging Het
Creld2 G A 15: 88,820,631 W103* probably null Het
Dbh A G 2: 27,168,222 D134G probably damaging Het
Dcbld1 G T 10: 52,317,035 C292F probably damaging Het
Dlgap5 T C 14: 47,407,773 K304E probably benign Het
Dnajc2 A G 5: 21,781,319 probably null Het
Eps8l2 G A 7: 141,361,852 V650M probably damaging Het
Erlin1 T C 19: 44,059,065 Y139C probably damaging Het
F5 C A 1: 164,182,917 R406S probably damaging Het
Fahd1 A T 17: 24,849,648 W152R possibly damaging Het
Farp2 T A 1: 93,528,702 S36T probably benign Het
Foxs1 A G 2: 152,932,840 C98R probably damaging Het
Gal3st4 T A 5: 138,265,410 K442N probably benign Het
Gm10644 G A 8: 83,933,850 probably benign Het
Gm8674 A T 13: 49,900,853 noncoding transcript Het
Gpr88 G T 3: 116,252,424 S79R possibly damaging Het
Heatr9 T G 11: 83,518,209 I171L possibly damaging Het
Hectd4 A G 5: 121,322,294 T2209A probably benign Het
Hsh2d A G 8: 72,193,521 T21A probably damaging Het
Irf4 A T 13: 30,761,462 Q397L probably benign Het
Itgae T A 11: 73,118,643 probably benign Het
Jrkl A T 9: 13,245,604 D17E possibly damaging Het
Kcna4 T C 2: 107,296,778 V619A probably benign Het
Kcnh6 T A 11: 106,017,444 Y295* probably null Het
Kif1b G A 4: 149,267,216 T263I probably damaging Het
Large2 G T 2: 92,365,825 probably benign Het
Lcp1 T A 14: 75,199,297 Y28N possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mccc2 T C 13: 99,948,530 probably null Het
Mlh3 T C 12: 85,261,668 Y1115C probably benign Het
Mlst8 C T 17: 24,477,290 W155* probably null Het
Myh10 T C 11: 68,790,208 L1025P probably damaging Het
Myof T A 19: 37,977,693 N393I probably damaging Het
Nalcn C T 14: 123,302,769 V1140I probably benign Het
Ncald C T 15: 37,397,080 A119T probably benign Het
Nipbl T C 15: 8,343,630 E1044G possibly damaging Het
Nupl1 T C 14: 60,238,531 K279R probably benign Het
Oas1a A T 5: 120,905,813 N85K possibly damaging Het
Olfr1076 A G 2: 86,508,999 D180G probably damaging Het
Olfr738 C T 14: 50,414,341 P266S probably damaging Het
Olfr870 T C 9: 20,171,028 Y181C probably benign Het
Pou2f2 C T 7: 25,100,156 A92T possibly damaging Het
Ppp1r16a T C 15: 76,693,068 L212P probably damaging Het
Pram1 A T 17: 33,641,157 I233F probably benign Het
Ptbp3 A T 4: 59,517,635 L84Q probably damaging Het
Ptgr2 A T 12: 84,302,322 Q145L probably benign Het
Ptpn23 A T 9: 110,386,507 D1396E probably damaging Het
Pudp T C 18: 50,568,207 N152D probably benign Het
Rbm20 T A 19: 53,864,087 L1166Q probably damaging Het
Rictor T G 15: 6,759,572 I223R probably damaging Het
Ripor1 A T 8: 105,616,886 E270D probably damaging Het
Rorc T C 3: 94,391,173 C322R probably damaging Het
Rpgrip1l T C 8: 91,232,924 D1116G probably benign Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Sptan1 C G 2: 30,011,036 Q1425E probably benign Het
Srd5a3 G A 5: 76,147,705 V81I probably benign Het
Stk36 T A 1: 74,634,187 S1080T probably benign Het
Sugp2 T A 8: 70,253,660 I790K probably damaging Het
Syde2 T G 3: 146,014,316 Y764* probably null Het
Tmem130 A G 5: 144,737,856 F353S probably damaging Het
Tmem131 T A 1: 36,796,266 K1591N probably damaging Het
Urb2 C A 8: 124,029,798 T748K possibly damaging Het
Uri1 A T 7: 37,961,678 I480K probably damaging Het
Zcchc3 A C 2: 152,413,681 V366G probably benign Het
Zfp292 G A 4: 34,805,100 S2648F possibly damaging Het
Zfp54 T C 17: 21,434,152 Y303H probably benign Het
Zfp729b A G 13: 67,593,220 F319L probably damaging Het
Zfp934 G A 13: 62,517,955 H291Y probably damaging Het
Other mutations in Exoc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00695:Exoc3 APN 13 74206906 critical splice donor site probably null
IGL01444:Exoc3 APN 13 74206935 missense probably damaging 1.00
IGL02095:Exoc3 APN 13 74180536 missense probably damaging 1.00
IGL02370:Exoc3 APN 13 74192761 missense probably benign 0.02
IGL02704:Exoc3 APN 13 74174144 missense probably benign 0.00
IGL03113:Exoc3 APN 13 74193113 nonsense probably null
R0037:Exoc3 UTSW 13 74199539 missense probably damaging 0.99
R0565:Exoc3 UTSW 13 74182275 critical splice donor site probably null
R1282:Exoc3 UTSW 13 74182292 missense probably benign 0.30
R1438:Exoc3 UTSW 13 74190179 missense probably damaging 1.00
R1694:Exoc3 UTSW 13 74190065 splice site probably null
R1913:Exoc3 UTSW 13 74182316 missense probably damaging 1.00
R2039:Exoc3 UTSW 13 74192977 missense probably benign
R4272:Exoc3 UTSW 13 74192644 missense probably damaging 1.00
R4852:Exoc3 UTSW 13 74199645 missense probably damaging 1.00
R5698:Exoc3 UTSW 13 74174015 missense probably benign 0.13
R5909:Exoc3 UTSW 13 74199524 missense probably damaging 0.98
R5969:Exoc3 UTSW 13 74172186 nonsense probably null
R6248:Exoc3 UTSW 13 74182281 missense probably benign 0.40
R6433:Exoc3 UTSW 13 74189187 missense possibly damaging 0.93
R6599:Exoc3 UTSW 13 74189158 splice site probably null
R6861:Exoc3 UTSW 13 74189200 missense probably benign
R7000:Exoc3 UTSW 13 74182166 missense probably benign 0.41
R7384:Exoc3 UTSW 13 74172156 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCAAGCAAGTTGGCTACAAG -3'
(R):5'- GAGTTGAGGGCTGTTCCTTACC -3'

Sequencing Primer
(F):5'- ACTCTGCTAACATCAAGTGGGGC -3'
(R):5'- CCTGCTGCTGTTTTCCAGGG -3'
Posted On2014-07-14