Incidental Mutation 'R1975:Zfp512b'
ID221524
Institutional Source Beutler Lab
Gene Symbol Zfp512b
Ensembl Gene ENSMUSG00000000823
Gene Namezinc finger protein 512B
SynonymsLOC269401, Znf512b
MMRRC Submission 039988-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1975 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location181582103-181592803 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 181587085 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 696 (R696*)
Ref Sequence ENSEMBL: ENSMUSP00000115601 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108789] [ENSMUST00000128553] [ENSMUST00000132714] [ENSMUST00000140103] [ENSMUST00000153998]
Predicted Effect probably null
Transcript: ENSMUST00000108789
AA Change: R686*
SMART Domains Protein: ENSMUSP00000104417
Gene: ENSMUSG00000000823
AA Change: R686*

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
ZnF_C2H2 106 128 5.83e1 SMART
ZnF_C2H2 141 164 3.89e-3 SMART
internal_repeat_1 168 224 4.38e-14 PROSPERO
internal_repeat_1 246 302 4.38e-14 PROSPERO
ZnF_C2H2 487 511 5.68e1 SMART
ZnF_C2H2 517 540 2.91e-2 SMART
low complexity region 547 560 N/A INTRINSIC
ZnF_C2H2 571 593 1.59e1 SMART
ZnF_C2H2 607 630 4.4e-2 SMART
Blast:ZnF_C2H2 727 756 8e-11 BLAST
ZnF_C2H2 761 784 1.45e-2 SMART
low complexity region 808 832 N/A INTRINSIC
low complexity region 838 856 N/A INTRINSIC
low complexity region 858 866 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122831
Predicted Effect probably null
Transcript: ENSMUST00000128553
AA Change: R696*
SMART Domains Protein: ENSMUSP00000115601
Gene: ENSMUSG00000000823
AA Change: R696*

DomainStartEndE-ValueType
ZnF_C2H2 85 107 5.83e1 SMART
low complexity region 111 124 N/A INTRINSIC
low complexity region 130 140 N/A INTRINSIC
ZnF_C2H2 151 174 3.89e-3 SMART
internal_repeat_1 178 234 1.6e-14 PROSPERO
internal_repeat_1 256 312 1.6e-14 PROSPERO
ZnF_C2H2 497 521 5.68e1 SMART
ZnF_C2H2 527 550 2.91e-2 SMART
low complexity region 557 570 N/A INTRINSIC
ZnF_C2H2 581 603 1.59e1 SMART
ZnF_C2H2 617 640 4.4e-2 SMART
internal_repeat_2 723 761 4.94e-7 PROSPERO
ZnF_C2H2 771 794 1.45e-2 SMART
low complexity region 818 842 N/A INTRINSIC
low complexity region 848 866 N/A INTRINSIC
low complexity region 868 876 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131866
Predicted Effect probably benign
Transcript: ENSMUST00000132538
SMART Domains Protein: ENSMUSP00000119677
Gene: ENSMUSG00000000823

DomainStartEndE-ValueType
ZnF_C2H2 46 70 5.68e1 SMART
ZnF_C2H2 76 99 2.91e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132714
SMART Domains Protein: ENSMUSP00000117711
Gene: ENSMUSG00000002455

DomainStartEndE-ValueType
Pfam:PRP1_N 1 54 6e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133598
SMART Domains Protein: ENSMUSP00000114378
Gene: ENSMUSG00000000823

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135561
SMART Domains Protein: ENSMUSP00000121721
Gene: ENSMUSG00000000823

DomainStartEndE-ValueType
ZnF_C2H2 12 35 1.45e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136759
Predicted Effect probably benign
Transcript: ENSMUST00000140103
SMART Domains Protein: ENSMUSP00000123579
Gene: ENSMUSG00000000823

DomainStartEndE-ValueType
Blast:ZnF_C2H2 2 24 8e-7 BLAST
ZnF_C2H2 29 52 1.45e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144856
SMART Domains Protein: ENSMUSP00000114982
Gene: ENSMUSG00000089917

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
Pfam:CPT 83 211 2.7e-10 PFAM
Pfam:PRK 85 253 7.7e-56 PFAM
Pfam:AAA_17 86 240 2.5e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150552
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152365
Predicted Effect probably benign
Transcript: ENSMUST00000153998
SMART Domains Protein: ENSMUSP00000123096
Gene: ENSMUSG00000000823

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155947
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183624
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 96% (71/74)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad12 T C 5: 121,604,259 T429A probably benign Het
Afmid A C 11: 117,836,474 I275L probably benign Het
Aimp1 A C 3: 132,677,099 D5E possibly damaging Het
Aldob G A 4: 49,538,171 A319V probably benign Het
Ankar C T 1: 72,658,441 V1068I possibly damaging Het
Ccr2 C T 9: 124,106,793 S370L probably benign Het
Chrnb4 A G 9: 55,034,818 Y391H probably damaging Het
Clip1 A G 5: 123,623,218 M873T possibly damaging Het
Cspg4 G C 9: 56,890,478 G1409R probably damaging Het
Dnah17 A T 11: 118,096,536 L1320* probably null Het
Dock4 T C 12: 40,779,642 probably benign Het
Eml4 T C 17: 83,410,193 S65P probably benign Het
Fblim1 A T 4: 141,584,864 D183E probably damaging Het
Foxn1 T C 11: 78,365,937 probably benign Het
Gm973 A T 1: 59,562,771 T515S possibly damaging Het
Hdac7 G A 15: 97,806,505 Q495* probably null Het
Hipk3 T C 2: 104,471,173 I225V probably benign Het
Hrc A T 7: 45,336,214 D263V probably damaging Het
Hs6st3 T C 14: 119,138,476 I21T probably benign Het
Il15ra A G 2: 11,723,523 T133A possibly damaging Het
Krt78 T C 15: 101,946,168 *1069W probably null Het
Lama3 T A 18: 12,453,863 M761K probably damaging Het
Lonp1 T C 17: 56,615,068 T771A possibly damaging Het
Macf1 T C 4: 123,489,212 T1320A probably damaging Het
Mark3 A T 12: 111,615,441 I115L probably damaging Het
Mcph1 T G 8: 18,689,065 probably benign Het
Med23 T A 10: 24,910,766 N923K probably benign Het
Msrb2 T G 2: 19,393,221 Y97D probably damaging Het
Muc6 C T 7: 141,648,101 G708S probably damaging Het
Mylk T C 16: 34,880,303 probably null Het
Nfrkb T A 9: 31,414,684 V1141E possibly damaging Het
Obscn T C 11: 59,067,729 E3675G probably damaging Het
Olfr1053 C G 2: 86,315,154 G44A probably damaging Het
Olfr167 G A 16: 19,514,836 P267S probably damaging Het
Olfr203 T C 16: 59,303,728 S193P probably damaging Het
Olfr612 A T 7: 103,538,994 F80Y probably damaging Het
Olfr619 A G 7: 103,604,012 probably null Het
Olfr720 A T 14: 14,175,446 V212E probably damaging Het
Olfr746 T A 14: 50,653,364 N42K probably damaging Het
Pan2 T C 10: 128,320,413 V1171A probably damaging Het
Pdgfc C T 3: 81,209,245 T302I probably damaging Het
Pkhd1l1 G T 15: 44,529,713 V1815F probably damaging Het
Pnpt1 A G 11: 29,141,256 I337V probably benign Het
Psma8 T G 18: 14,730,976 probably null Het
Rbl2 T C 8: 91,085,462 S220P probably benign Het
Rere T A 4: 150,615,733 D1091E probably damaging Het
Rpa1 A G 11: 75,306,176 C540R probably damaging Het
Sema3d T A 5: 12,563,318 V454E probably damaging Het
Sema3d T C 5: 12,584,998 V677A probably benign Het
Sgk2 A G 2: 163,004,160 N207S probably benign Het
Sirpb1a T C 3: 15,379,081 I370V probably benign Het
Slc22a19 A G 19: 7,683,859 probably benign Het
Slc26a1 T A 5: 108,672,472 D287V probably damaging Het
Slc36a4 T A 9: 15,734,210 V311D probably damaging Het
Slco1b2 A T 6: 141,683,225 Y551F probably damaging Het
Slco2a1 T A 9: 103,079,454 Y488* probably null Het
Stab2 A C 10: 86,896,496 probably null Het
Strn T C 17: 78,692,499 probably null Het
Tbxas1 A G 6: 38,948,641 probably benign Het
Thumpd3 A G 6: 113,055,877 N192S possibly damaging Het
Tns3 T A 11: 8,435,738 I1386F probably benign Het
Treml4 T A 17: 48,272,793 V219E probably damaging Het
Triobp T C 15: 78,966,708 V354A probably benign Het
Tspan8 A G 10: 115,844,130 I217V probably benign Het
Tub G A 7: 109,027,835 G314R possibly damaging Het
Ube3b C T 5: 114,399,865 T339M possibly damaging Het
Vmn2r43 A G 7: 8,255,551 I221T possibly damaging Het
Vmn2r5 C T 3: 64,504,221 E309K probably damaging Het
Zfp110 C T 7: 12,848,502 T359I probably benign Het
Zfp322a A T 13: 23,356,904 C223S probably damaging Het
Other mutations in Zfp512b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Zfp512b APN 2 181587069 missense probably damaging 0.98
IGL00667:Zfp512b APN 2 181589733 missense probably damaging 0.97
IGL00763:Zfp512b APN 2 181590151 missense probably damaging 1.00
IGL01448:Zfp512b APN 2 181587785 missense possibly damaging 0.62
IGL01788:Zfp512b APN 2 181588763 missense possibly damaging 0.86
IGL02048:Zfp512b APN 2 181589922 missense possibly damaging 0.77
IGL02752:Zfp512b APN 2 181588071 missense possibly damaging 0.46
IGL03238:Zfp512b APN 2 181589760 missense probably damaging 1.00
R0421:Zfp512b UTSW 2 181588258 nonsense probably null
R0507:Zfp512b UTSW 2 181584964 unclassified probably benign
R0713:Zfp512b UTSW 2 181588300 missense possibly damaging 0.79
R1074:Zfp512b UTSW 2 181589179 missense probably damaging 0.96
R1513:Zfp512b UTSW 2 181589189 missense probably benign 0.00
R1560:Zfp512b UTSW 2 181588679 missense probably benign 0.00
R1595:Zfp512b UTSW 2 181588436 missense probably damaging 1.00
R1673:Zfp512b UTSW 2 181588493 missense possibly damaging 0.61
R1845:Zfp512b UTSW 2 181585735 missense probably damaging 1.00
R1888:Zfp512b UTSW 2 181588442 missense probably damaging 0.99
R1888:Zfp512b UTSW 2 181588442 missense probably damaging 0.99
R1943:Zfp512b UTSW 2 181588415 missense probably damaging 1.00
R2520:Zfp512b UTSW 2 181589502 missense probably damaging 1.00
R3876:Zfp512b UTSW 2 181588763 frame shift probably null
R3877:Zfp512b UTSW 2 181588763 frame shift probably null
R4171:Zfp512b UTSW 2 181590598 unclassified probably null
R4607:Zfp512b UTSW 2 181588774 missense probably damaging 1.00
R4732:Zfp512b UTSW 2 181588739 missense probably benign
R4733:Zfp512b UTSW 2 181588739 missense probably benign
R4766:Zfp512b UTSW 2 181585095 unclassified probably benign
R4888:Zfp512b UTSW 2 181587063 missense probably damaging 1.00
R4965:Zfp512b UTSW 2 181586338 missense probably damaging 1.00
R5632:Zfp512b UTSW 2 181585668 missense probably benign 0.27
R6897:Zfp512b UTSW 2 181590480 missense probably damaging 1.00
R6970:Zfp512b UTSW 2 181586348 missense possibly damaging 0.92
R7432:Zfp512b UTSW 2 181589856 missense probably benign
R7560:Zfp512b UTSW 2 181587082 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACAATGCAACGTGCTTCTG -3'
(R):5'- GGCTTATACTGGCCTCTGTC -3'

Sequencing Primer
(F):5'- CTTCTGCAGCGGGCTCATTG -3'
(R):5'- GGCTTATACTGGCCTCTGTCTATCC -3'
Posted On2014-08-25