Mutagenetix > Incidental Mutation

Incidental Mutation 'R3876:Zfp512b'

276832

Institutional Source

Beutler Lab

Gene Symbol

Zfp512b

Ensembl Gene

ENSMUSG00000000823

Gene Name

zinc finger protein 512B

Synonyms

LOC269401, Znf512b

MMRRC Submission

041606-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3876 (G1)

Quality Score

217

Status

Validated

Chromosome

Chromosomal Location

181582103-181592803 bp(-) (GRCm38)

Type of Mutation

frame shift

DNA Base Change (assembly)

AG to AGG at 181588763 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000115601 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000108789] [ENSMUST00000128553] [ENSMUST00000132714] [ENSMUST00000140103] [ENSMUST00000153998]

AlphaFold

Q6PHP4

Predicted Effect

probably null
Transcript: ENSMUST00000108789

SMART Domains

Protein: ENSMUSP00000104417
Gene: ENSMUSG00000000823

Domain	Start	End	E-Value	Type
low complexity region	15	26	N/A	INTRINSIC
ZnF_C2H2	106	128	5.83e1	SMART
ZnF_C2H2	141	164	3.89e-3	SMART
internal_repeat_1	168	224	4.38e-14	PROSPERO
internal_repeat_1	246	302	4.38e-14	PROSPERO
ZnF_C2H2	487	511	5.68e1	SMART
ZnF_C2H2	517	540	2.91e-2	SMART
low complexity region	547	560	N/A	INTRINSIC
ZnF_C2H2	571	593	1.59e1	SMART
ZnF_C2H2	607	630	4.4e-2	SMART
Blast:ZnF_C2H2	727	756	8e-11	BLAST
ZnF_C2H2	761	784	1.45e-2	SMART
low complexity region	808	832	N/A	INTRINSIC
low complexity region	838	856	N/A	INTRINSIC
low complexity region	858	866	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000128553

SMART Domains

Protein: ENSMUSP00000115601
Gene: ENSMUSG00000000823

Domain	Start	End	E-Value	Type
ZnF_C2H2	85	107	5.83e1	SMART
low complexity region	111	124	N/A	INTRINSIC
low complexity region	130	140	N/A	INTRINSIC
ZnF_C2H2	151	174	3.89e-3	SMART
internal_repeat_1	178	234	1.6e-14	PROSPERO
internal_repeat_1	256	312	1.6e-14	PROSPERO
ZnF_C2H2	497	521	5.68e1	SMART
ZnF_C2H2	527	550	2.91e-2	SMART
low complexity region	557	570	N/A	INTRINSIC
ZnF_C2H2	581	603	1.59e1	SMART
ZnF_C2H2	617	640	4.4e-2	SMART
internal_repeat_2	723	761	4.94e-7	PROSPERO
ZnF_C2H2	771	794	1.45e-2	SMART
low complexity region	818	842	N/A	INTRINSIC
low complexity region	848	866	N/A	INTRINSIC
low complexity region	868	876	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131866

Predicted Effect

probably benign
Transcript: ENSMUST00000132538

SMART Domains

Protein: ENSMUSP00000119677
Gene: ENSMUSG00000000823

Domain	Start	End	E-Value	Type
ZnF_C2H2	46	70	5.68e1	SMART
ZnF_C2H2	76	99	2.91e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000132714

SMART Domains

Protein: ENSMUSP00000117711
Gene: ENSMUSG00000002455

Domain	Start	End	E-Value	Type
Pfam:PRP1_N	1	54	6e-11	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133598

SMART Domains

Protein: ENSMUSP00000114378
Gene: ENSMUSG00000000823

Domain	Start	End	E-Value	Type
low complexity region	15	26	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000135561

SMART Domains

Protein: ENSMUSP00000121721
Gene: ENSMUSG00000000823

Domain	Start	End	E-Value	Type
ZnF_C2H2	12	35	1.45e-2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136759

Predicted Effect

probably benign
Transcript: ENSMUST00000140103

SMART Domains

Protein: ENSMUSP00000123579
Gene: ENSMUSG00000000823

Domain	Start	End	E-Value	Type
Blast:ZnF_C2H2	2	24	8e-7	BLAST
ZnF_C2H2	29	52	1.45e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000144856

SMART Domains

Protein: ENSMUSP00000114982
Gene: ENSMUSG00000089917

Domain	Start	End	E-Value	Type
low complexity region	1	12	N/A	INTRINSIC
Pfam:CPT	83	211	2.7e-10	PFAM
Pfam:PRK	85	253	7.7e-56	PFAM
Pfam:AAA_17	86	240	2.5e-8	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150552

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152365

Predicted Effect

probably benign
Transcript: ENSMUST00000153998

SMART Domains

Protein: ENSMUSP00000123096
Gene: ENSMUSG00000000823

Domain	Start	End	E-Value	Type
low complexity region	15	26	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155947

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183624

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

100% (53/53)

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931414P19Rik	G	A	14: 54,591,400	R215*	probably null	Het
Brinp2	C	A	1: 158,246,846	L568F	probably damaging	Het
Brip1	T	C	11: 86,152,790	Y316C	probably damaging	Het
Cdk5rap2	ATGTG	ATG	4: 70,289,977		probably null	Het
Cfap69	G	T	5: 5,584,645		probably benign	Het
Chrnb4	T	C	9: 55,043,898	E27G	probably damaging	Het
Clec14a	A	G	12: 58,268,644	V64A	possibly damaging	Het
Crygs	A	G	16: 22,806,512	Y60H	probably damaging	Het
Dpp10	T	A	1: 123,353,487	Q611L	probably damaging	Het
Entpd1	T	C	19: 40,736,820	L450P	probably damaging	Het
Eogt	G	A	6: 97,120,190	S317L	probably damaging	Het
Exosc10	T	A	4: 148,572,919	S584T	probably benign	Het
Fam184a	C	T	10: 53,699,061	V151I	probably damaging	Het
Fbxo43	A	G	15: 36,152,112	V517A	probably damaging	Het
Flii	T	C	11: 60,719,872	T533A	possibly damaging	Het
Frmpd1	T	G	4: 45,284,093	H971Q	probably benign	Het
Gata3	A	T	2: 9,863,143	N333K	probably damaging	Het
Hectd1	A	G	12: 51,768,730	S1525P	probably damaging	Het
Ibtk	A	G	9: 85,718,426	I816T	probably benign	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Krt34	T	C	11: 100,040,965	T143A	probably benign	Het
Lipn	G	T	19: 34,069,428	M43I	probably benign	Het
Lrp1b	A	G	2: 41,445,194	C779R	probably damaging	Het
Mios	G	A	6: 8,233,189	R779Q	probably damaging	Het
Mme	A	T	3: 63,362,059		probably benign	Het
Ncstn	A	G	1: 172,070,073	S418P	probably benign	Het
Olfr1209	T	C	2: 88,909,608	T262A	possibly damaging	Het
Olfr1285	T	C	2: 111,408,622	V69A	possibly damaging	Het
Olfr5	G	A	7: 6,481,132	A8V	probably benign	Het
Olfr800	C	T	10: 129,660,274	P156L	probably benign	Het
Olfr934	T	A	9: 38,982,870	Y58F	probably damaging	Het
Oprk1	T	A	1: 5,602,661	C340*	probably null	Het
Pald1	T	A	10: 61,347,487	N323Y	probably damaging	Het
Pcdhac1	C	A	18: 37,091,892	A586E	probably damaging	Het
Pcnx2	C	T	8: 125,888,158	A185T	probably benign	Het
Pik3r1	G	A	13: 101,684,957	H430Y	probably benign	Het
Polr3b	G	A	10: 84,720,518		probably null	Het
Prl8a6	A	T	13: 27,433,032	L225*	probably null	Het
Psme4	T	C	11: 30,856,068	S89P	probably damaging	Het
Pygl	G	A	12: 70,201,339	T250I	probably damaging	Het
Rgs13	T	A	1: 144,140,790	K72*	probably null	Het
Ryr2	T	A	13: 11,588,159	I4514F	probably damaging	Het
Sept3	A	T	15: 82,285,801	D32V	probably damaging	Het
Sfrp2	C	T	3: 83,767,028	P163S	possibly damaging	Het
Spata31	A	G	13: 64,920,931	T298A	probably benign	Het
Stxbp2	T	C	8: 3,633,369		probably null	Het
Syne1	A	T	10: 5,052,345	M282K	possibly damaging	Het
Timd2	T	C	11: 46,671,020		probably null	Het
Tlr11	G	A	14: 50,363,154	V866I	probably benign	Het
Trappc10	T	C	10: 78,220,186		probably null	Het

Other mutations in Zfp512b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00492:Zfp512b	APN	2	181587069	missense	probably damaging	0.98
IGL00667:Zfp512b	APN	2	181589733	missense	probably damaging	0.97
IGL00763:Zfp512b	APN	2	181590151	missense	probably damaging	1.00
IGL01448:Zfp512b	APN	2	181587785	missense	possibly damaging	0.62
IGL01788:Zfp512b	APN	2	181588763	missense	possibly damaging	0.86
IGL02048:Zfp512b	APN	2	181589922	missense	possibly damaging	0.77
IGL02752:Zfp512b	APN	2	181588071	missense	possibly damaging	0.46
IGL03238:Zfp512b	APN	2	181589760	missense	probably damaging	1.00
R0421:Zfp512b	UTSW	2	181588258	nonsense	probably null
R0507:Zfp512b	UTSW	2	181584964	unclassified	probably benign
R0713:Zfp512b	UTSW	2	181588300	missense	possibly damaging	0.79
R1074:Zfp512b	UTSW	2	181589179	missense	probably damaging	0.96
R1513:Zfp512b	UTSW	2	181589189	missense	probably benign	0.00
R1560:Zfp512b	UTSW	2	181588679	missense	probably benign	0.00
R1595:Zfp512b	UTSW	2	181588436	missense	probably damaging	1.00
R1673:Zfp512b	UTSW	2	181588493	missense	possibly damaging	0.61
R1845:Zfp512b	UTSW	2	181585735	missense	probably damaging	1.00
R1888:Zfp512b	UTSW	2	181588442	missense	probably damaging	0.99
R1888:Zfp512b	UTSW	2	181588442	missense	probably damaging	0.99
R1943:Zfp512b	UTSW	2	181588415	missense	probably damaging	1.00
R1975:Zfp512b	UTSW	2	181587085	nonsense	probably null
R2520:Zfp512b	UTSW	2	181589502	missense	probably damaging	1.00
R3877:Zfp512b	UTSW	2	181588763	frame shift	probably null
R4171:Zfp512b	UTSW	2	181590598	splice site	probably null
R4607:Zfp512b	UTSW	2	181588774	missense	probably damaging	1.00
R4732:Zfp512b	UTSW	2	181588739	missense	probably benign
R4733:Zfp512b	UTSW	2	181588739	missense	probably benign
R4766:Zfp512b	UTSW	2	181585095	unclassified	probably benign
R4888:Zfp512b	UTSW	2	181587063	missense	probably damaging	1.00
R4965:Zfp512b	UTSW	2	181586338	missense	probably damaging	1.00
R5632:Zfp512b	UTSW	2	181585668	missense	probably benign	0.27
R6897:Zfp512b	UTSW	2	181590480	missense	probably damaging	1.00
R6970:Zfp512b	UTSW	2	181586348	missense	possibly damaging	0.92
R7432:Zfp512b	UTSW	2	181589856	missense	probably benign
R7560:Zfp512b	UTSW	2	181587082	missense	probably damaging	1.00
R7935:Zfp512b	UTSW	2	181589896	missense	probably damaging	1.00
R8045:Zfp512b	UTSW	2	181584824	makesense	probably null
R8321:Zfp512b	UTSW	2	181587138	missense	possibly damaging	0.86
R8821:Zfp512b	UTSW	2	181586732	missense	probably benign	0.01
R8913:Zfp512b	UTSW	2	181585489	missense
R9010:Zfp512b	UTSW	2	181588218	missense	possibly damaging	0.59

Predicted Primers

PCR Primer
(F):5'- CGATGCCTTTGCTACAGGATC -3'
(R):5'- CAGGGTCTTGGCACTCATTTTC -3'

Sequencing Primer
(F):5'- TTGCTACAGGATCCAGCCC -3'
(R):5'- GGGGAGCAACCATCTATCTCAG -3'

Posted On

2015-04-06