Incidental Mutation 'R4766:Zfp512b'
ID366122
Institutional Source Beutler Lab
Gene Symbol Zfp512b
Ensembl Gene ENSMUSG00000000823
Gene Namezinc finger protein 512B
SynonymsLOC269401, Znf512b
MMRRC Submission 042407-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4766 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location181582103-181592803 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 181585095 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000057816] [ENSMUST00000108789] [ENSMUST00000128553] [ENSMUST00000129469] [ENSMUST00000131949] [ENSMUST00000140103]
Predicted Effect probably benign
Transcript: ENSMUST00000057816
SMART Domains Protein: ENSMUSP00000050398
Gene: ENSMUSG00000089917

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
Pfam:CPT 98 249 7e-10 PFAM
Pfam:PRK 100 288 5.7e-61 PFAM
Pfam:UPRTase 326 532 2.6e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108789
SMART Domains Protein: ENSMUSP00000104417
Gene: ENSMUSG00000000823

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
ZnF_C2H2 106 128 5.83e1 SMART
ZnF_C2H2 141 164 3.89e-3 SMART
internal_repeat_1 168 224 4.38e-14 PROSPERO
internal_repeat_1 246 302 4.38e-14 PROSPERO
ZnF_C2H2 487 511 5.68e1 SMART
ZnF_C2H2 517 540 2.91e-2 SMART
low complexity region 547 560 N/A INTRINSIC
ZnF_C2H2 571 593 1.59e1 SMART
ZnF_C2H2 607 630 4.4e-2 SMART
Blast:ZnF_C2H2 727 756 8e-11 BLAST
ZnF_C2H2 761 784 1.45e-2 SMART
low complexity region 808 832 N/A INTRINSIC
low complexity region 838 856 N/A INTRINSIC
low complexity region 858 866 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122831
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123110
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126672
Predicted Effect probably benign
Transcript: ENSMUST00000128553
SMART Domains Protein: ENSMUSP00000115601
Gene: ENSMUSG00000000823

DomainStartEndE-ValueType
ZnF_C2H2 85 107 5.83e1 SMART
low complexity region 111 124 N/A INTRINSIC
low complexity region 130 140 N/A INTRINSIC
ZnF_C2H2 151 174 3.89e-3 SMART
internal_repeat_1 178 234 1.6e-14 PROSPERO
internal_repeat_1 256 312 1.6e-14 PROSPERO
ZnF_C2H2 497 521 5.68e1 SMART
ZnF_C2H2 527 550 2.91e-2 SMART
low complexity region 557 570 N/A INTRINSIC
ZnF_C2H2 581 603 1.59e1 SMART
ZnF_C2H2 617 640 4.4e-2 SMART
internal_repeat_2 723 761 4.94e-7 PROSPERO
ZnF_C2H2 771 794 1.45e-2 SMART
low complexity region 818 842 N/A INTRINSIC
low complexity region 848 866 N/A INTRINSIC
low complexity region 868 876 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129469
SMART Domains Protein: ENSMUSP00000121607
Gene: ENSMUSG00000089917

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
Pfam:CPT 98 210 5.1e-10 PFAM
Pfam:AAA_17 100 251 1.1e-8 PFAM
Pfam:PRK 100 288 3.4e-60 PFAM
Pfam:AAA_18 101 257 5.8e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131866
Predicted Effect probably benign
Transcript: ENSMUST00000131949
Predicted Effect probably benign
Transcript: ENSMUST00000132538
SMART Domains Protein: ENSMUSP00000119677
Gene: ENSMUSG00000000823

DomainStartEndE-ValueType
ZnF_C2H2 46 70 5.68e1 SMART
ZnF_C2H2 76 99 2.91e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133598
SMART Domains Protein: ENSMUSP00000114378
Gene: ENSMUSG00000000823

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148847
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183624
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146823
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136759
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148004
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155947
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150552
Predicted Effect probably benign
Transcript: ENSMUST00000135561
SMART Domains Protein: ENSMUSP00000121721
Gene: ENSMUSG00000000823

DomainStartEndE-ValueType
ZnF_C2H2 12 35 1.45e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140103
SMART Domains Protein: ENSMUSP00000123579
Gene: ENSMUSG00000000823

DomainStartEndE-ValueType
Blast:ZnF_C2H2 2 24 8e-7 BLAST
ZnF_C2H2 29 52 1.45e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144856
SMART Domains Protein: ENSMUSP00000114982
Gene: ENSMUSG00000089917

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
Pfam:CPT 83 211 2.7e-10 PFAM
Pfam:PRK 85 253 7.7e-56 PFAM
Pfam:AAA_17 86 240 2.5e-8 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 97% (87/90)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik C T 5: 113,097,636 V1584I probably benign Het
A430105I19Rik C A 2: 118,759,577 R262L probably damaging Het
Adamts12 A G 15: 11,285,901 D732G probably benign Het
Agpat4 A G 17: 12,151,750 probably benign Het
AI182371 T C 2: 35,095,817 D140G possibly damaging Het
Apol11b T A 15: 77,634,933 T316S probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Bard1 T C 1: 71,075,174 E216G probably benign Het
Bdp1 C A 13: 100,049,868 R1692L probably damaging Het
Capn10 T C 1: 92,943,419 I101T probably damaging Het
Ccdc175 C T 12: 72,112,205 M653I probably benign Het
Ccr8 G A 9: 120,094,464 C215Y probably damaging Het
Cct3 T A 3: 88,311,785 L241* probably null Het
Cd2ap A T 17: 42,852,459 I25N probably damaging Het
Cdh19 T C 1: 110,893,260 K583E probably benign Het
Cela3a A G 4: 137,402,675 S212P unknown Het
Cfap44 T A 16: 44,415,883 probably null Het
Clca3a1 A T 3: 144,749,712 L440Q probably damaging Het
Crybg2 A G 4: 134,089,352 Y1676C probably damaging Het
Dscam T C 16: 96,643,988 D1501G probably benign Het
Eml6 C A 11: 29,805,757 L832F probably benign Het
Enpp3 A G 10: 24,773,927 L867P probably damaging Het
Erbb3 A G 10: 128,586,238 Y46H possibly damaging Het
Fads3 T C 19: 10,056,020 I342T possibly damaging Het
Flvcr1 A T 1: 191,021,106 S290T probably benign Het
Fut9 A G 4: 25,799,191 probably benign Het
Gad2 C T 2: 22,622,667 A2V probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm10715 T G 9: 3,038,073 probably benign Het
Herc1 T G 9: 66,441,929 D2023E probably benign Het
Hsd3b3 A G 3: 98,742,485 L174P probably damaging Het
Impg2 TACCACCACCACCACCACCACCACCA TACCACCACCACCACCACCACCA 16: 56,257,939 probably benign Het
Iqcf3 A G 9: 106,560,949 probably null Het
Kcna4 G A 2: 107,296,543 V541M probably damaging Het
Kcnj11 T C 7: 46,099,816 T28A probably benign Het
Kcnmb2 T A 3: 32,181,867 N88K probably damaging Het
Kdm2a TTCCTCCTCCTCCTCCTCTTCCTCCTCCTC TTCCTCCTCCTCCTCTTCCTCCTCCTC 19: 4,324,507 probably benign Het
Krt2 T C 15: 101,813,960 E430G probably damaging Het
Lins1 C T 7: 66,710,641 L384F possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mfge8 T C 7: 79,134,525 N389D probably damaging Het
Mug1 C T 6: 121,884,254 T1278I probably benign Het
Myh9 T C 15: 77,807,877 M161V probably damaging Het
Myl7 T A 11: 5,898,171 Y61F probably benign Het
Nlrp4d A T 7: 10,362,779 unknown Het
Nol3 A G 8: 105,281,933 probably null Het
Nup85 T A 11: 115,577,925 probably null Het
Obscn T A 11: 59,012,742 T7619S probably damaging Het
Olfr1298 T C 2: 111,645,881 M39V probably benign Het
Olfr331 T A 11: 58,501,668 N296I probably damaging Het
Olfr628 C T 7: 103,732,250 T108I possibly damaging Het
Olfr844 G A 9: 19,318,845 V104I probably benign Het
Pax5 T A 4: 44,679,494 I184F probably damaging Het
Pcdha7 T A 18: 36,974,507 V195D probably damaging Het
Phf3 A T 1: 30,813,939 probably benign Het
Pla2g15 G T 8: 106,163,071 G325V probably damaging Het
Ppp1r21 T C 17: 88,572,615 F487L probably benign Het
Ppp1r9a A G 6: 5,157,016 I965V probably benign Het
Ptpru A G 4: 131,820,964 V74A probably damaging Het
Rif1 T A 2: 52,098,934 Y780N probably damaging Het
Rps25 T A 9: 44,408,749 Y23N possibly damaging Het
Ryr1 T C 7: 29,085,833 D1811G probably damaging Het
Scamp5 T G 9: 57,452,036 probably null Het
Senp1 T C 15: 98,045,896 D602G probably damaging Het
Sh2b2 T G 5: 136,231,957 D135A probably damaging Het
Slc26a8 G A 17: 28,638,661 T836M probably benign Het
Slfn4 T G 11: 83,186,821 I145S possibly damaging Het
Spag6l G A 16: 16,777,390 T377I probably benign Het
Spdye4b T C 5: 143,196,334 F129S probably damaging Het
Sspo G A 6: 48,470,580 G2360E probably benign Het
Taar2 A T 10: 23,940,771 I70F probably damaging Het
Taar7e A G 10: 24,038,566 N318S probably damaging Het
Tor1a C A 2: 30,967,730 R42L probably benign Het
Trdn A T 10: 33,474,506 Q690H probably benign Het
Trim56 C A 5: 137,112,725 V646L probably benign Het
Tspan15 T A 10: 62,191,544 K165I probably benign Het
Usp24 A G 4: 106,416,048 Y2210C probably damaging Het
Usp45 A G 4: 21,797,307 T76A probably damaging Het
Vps13c T A 9: 67,878,224 probably null Het
Zyx C A 6: 42,356,159 probably null Het
Other mutations in Zfp512b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Zfp512b APN 2 181587069 missense probably damaging 0.98
IGL00667:Zfp512b APN 2 181589733 missense probably damaging 0.97
IGL00763:Zfp512b APN 2 181590151 missense probably damaging 1.00
IGL01448:Zfp512b APN 2 181587785 missense possibly damaging 0.62
IGL01788:Zfp512b APN 2 181588763 missense possibly damaging 0.86
IGL02048:Zfp512b APN 2 181589922 missense possibly damaging 0.77
IGL02752:Zfp512b APN 2 181588071 missense possibly damaging 0.46
IGL03238:Zfp512b APN 2 181589760 missense probably damaging 1.00
R0421:Zfp512b UTSW 2 181588258 nonsense probably null
R0507:Zfp512b UTSW 2 181584964 unclassified probably benign
R0713:Zfp512b UTSW 2 181588300 missense possibly damaging 0.79
R1074:Zfp512b UTSW 2 181589179 missense probably damaging 0.96
R1513:Zfp512b UTSW 2 181589189 missense probably benign 0.00
R1560:Zfp512b UTSW 2 181588679 missense probably benign 0.00
R1595:Zfp512b UTSW 2 181588436 missense probably damaging 1.00
R1673:Zfp512b UTSW 2 181588493 missense possibly damaging 0.61
R1845:Zfp512b UTSW 2 181585735 missense probably damaging 1.00
R1888:Zfp512b UTSW 2 181588442 missense probably damaging 0.99
R1888:Zfp512b UTSW 2 181588442 missense probably damaging 0.99
R1943:Zfp512b UTSW 2 181588415 missense probably damaging 1.00
R1975:Zfp512b UTSW 2 181587085 nonsense probably null
R2520:Zfp512b UTSW 2 181589502 missense probably damaging 1.00
R3876:Zfp512b UTSW 2 181588763 frame shift probably null
R3877:Zfp512b UTSW 2 181588763 frame shift probably null
R4171:Zfp512b UTSW 2 181590598 splice site probably null
R4607:Zfp512b UTSW 2 181588774 missense probably damaging 1.00
R4732:Zfp512b UTSW 2 181588739 missense probably benign
R4733:Zfp512b UTSW 2 181588739 missense probably benign
R4888:Zfp512b UTSW 2 181587063 missense probably damaging 1.00
R4965:Zfp512b UTSW 2 181586338 missense probably damaging 1.00
R5632:Zfp512b UTSW 2 181585668 missense probably benign 0.27
R6897:Zfp512b UTSW 2 181590480 missense probably damaging 1.00
R6970:Zfp512b UTSW 2 181586348 missense possibly damaging 0.92
R7432:Zfp512b UTSW 2 181589856 missense probably benign
R7560:Zfp512b UTSW 2 181587082 missense probably damaging 1.00
R7935:Zfp512b UTSW 2 181589896 missense probably damaging 1.00
R8045:Zfp512b UTSW 2 181584824 makesense probably null
R8321:Zfp512b UTSW 2 181587138 missense possibly damaging 0.86
R8821:Zfp512b UTSW 2 181586732 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCTTAGATGCTGGCTCCTC -3'
(R):5'- TCCTAATGGTTGTATGCCCAG -3'

Sequencing Primer
(F):5'- TCCTCGGAGGATCGTTCC -3'
(R):5'- GAGGACCAGAGTTTATTTCCCAGC -3'
Posted On2015-12-21