Incidental Mutation 'R2039:Npy6r'
ID225467
Institutional Source Beutler Lab
Gene Symbol Npy6r
Ensembl Gene ENSMUSG00000038071
Gene Nameneuropeptide Y receptor Y6
Synonyms
MMRRC Submission 040046-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2039 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location44270127-44277700 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44276003 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 164 (T164A)
Ref Sequence ENSEMBL: ENSMUSP00000040797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042747]
Predicted Effect probably benign
Transcript: ENSMUST00000042747
AA Change: T164A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000040797
Gene: ENSMUSG00000038071
AA Change: T164A

DomainStartEndE-ValueType
low complexity region 33 41 N/A INTRINSIC
Pfam:7tm_1 52 318 3.5e-51 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 96% (45/47)
MGI Phenotype PHENOTYPE: Mice homozygous for a reporter allele exhibit enhanced performance on the rotarod test. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,284,676 S4167P probably damaging Het
4932438A13Rik T A 3: 37,003,878 F3206I possibly damaging Het
A2m C A 6: 121,659,949 T757K probably benign Het
Abca14 T C 7: 120,312,264 V1357A probably damaging Het
Abca5 A G 11: 110,299,929 F785S probably damaging Het
Arntl T G 7: 113,285,112 L119R probably damaging Het
Cacna1h T C 17: 25,391,845 I554V probably benign Het
Cuzd1 T C 7: 131,309,616 S545G probably benign Het
Cuzd1 A T 7: 131,314,914 probably benign Het
Edrf1 T A 7: 133,653,949 Y574* probably null Het
Eef1d T C 15: 75,895,769 D252G probably damaging Het
Efna5 T G 17: 62,881,066 D22A probably benign Het
Esyt1 C T 10: 128,511,951 V957I probably benign Het
Etl4 T C 2: 20,785,228 S881P probably damaging Het
Exoc3 A G 13: 74,192,977 I236T probably benign Het
Fam19a1 C A 6: 96,654,764 probably null Het
Far2 T C 6: 148,165,577 L320S probably benign Het
Fsd1l T A 4: 53,679,972 D223E probably benign Het
Fut1 C T 7: 45,618,991 A123V possibly damaging Het
Gap43 A T 16: 42,292,352 D15E possibly damaging Het
Gm12789 T C 4: 101,988,986 probably benign Het
Gm5114 T A 7: 39,409,188 T336S probably damaging Het
Hhla1 G A 15: 65,936,377 T273I possibly damaging Het
Hira A G 16: 18,951,701 H812R probably benign Het
Hsp90aa1 T C 12: 110,693,782 N360S probably damaging Het
Kmt2c A G 5: 25,329,040 L1463S possibly damaging Het
Lman2l A G 1: 36,428,454 F171S probably damaging Het
Lrfn5 T C 12: 61,840,323 L299S possibly damaging Het
Msr1 A T 8: 39,589,377 W386R probably damaging Het
Myo1e T C 9: 70,320,133 V162A possibly damaging Het
Olfr677 T C 7: 105,056,390 L48P possibly damaging Het
Rbak C A 5: 143,173,175 V708L probably benign Het
Rev3l A G 10: 39,824,444 I1646V probably damaging Het
Rsrc1 A G 3: 66,994,618 T34A unknown Het
Sept9 G A 11: 117,351,617 V53I probably damaging Het
Snrnp200 G A 2: 127,234,984 A1646T probably benign Het
Sqor G A 2: 122,792,404 probably null Het
St7 T C 6: 17,886,112 Y358H probably damaging Het
Tas2r126 T A 6: 42,434,623 M30K probably benign Het
Thsd7a G A 6: 12,408,923 T700I possibly damaging Het
Ttn T G 2: 76,868,466 probably benign Het
Ugt1a10 T G 1: 88,055,981 I167S probably benign Het
Uhmk1 T C 1: 170,212,267 D88G probably damaging Het
Washc2 T A 6: 116,224,439 F332Y probably damaging Het
Wdr48 T A 9: 119,909,387 W38R probably damaging Het
Zfc3h1 A G 10: 115,406,483 D622G probably damaging Het
Other mutations in Npy6r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Npy6r APN 18 44276444 missense probably damaging 1.00
IGL00767:Npy6r APN 18 44276318 missense probably benign 0.01
IGL01103:Npy6r APN 18 44275518 missense probably benign 0.15
IGL02085:Npy6r APN 18 44275931 missense probably damaging 1.00
IGL02653:Npy6r APN 18 44276627 makesense probably null
IGL03305:Npy6r APN 18 44275854 missense probably damaging 1.00
R0588:Npy6r UTSW 18 44275821 missense possibly damaging 0.94
R1993:Npy6r UTSW 18 44276508 missense probably damaging 1.00
R2567:Npy6r UTSW 18 44275821 missense possibly damaging 0.68
R4572:Npy6r UTSW 18 44275917 missense probably benign 0.03
R4584:Npy6r UTSW 18 44276195 missense probably damaging 1.00
R4611:Npy6r UTSW 18 44276401 missense probably damaging 1.00
R4741:Npy6r UTSW 18 44275724 missense probably damaging 1.00
R5145:Npy6r UTSW 18 44276619 missense probably benign 0.04
R5603:Npy6r UTSW 18 44276585 missense probably damaging 1.00
R5610:Npy6r UTSW 18 44275994 missense probably benign
R6030:Npy6r UTSW 18 44276082 missense probably benign 0.02
R6030:Npy6r UTSW 18 44276082 missense probably benign 0.02
R6083:Npy6r UTSW 18 44276492 missense probably damaging 0.99
R6364:Npy6r UTSW 18 44276511 missense possibly damaging 0.86
R7146:Npy6r UTSW 18 44275721 missense probably benign 0.30
R7178:Npy6r UTSW 18 44276484 missense probably damaging 1.00
R7180:Npy6r UTSW 18 44276156 missense probably benign
R7203:Npy6r UTSW 18 44275932 missense probably damaging 1.00
R7448:Npy6r UTSW 18 44276193 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGAACACTATGTGTAAACTCAC -3'
(R):5'- TTTCGGAGGCAGAGAACGATC -3'

Sequencing Primer
(F):5'- CACTTCCTACGTGCAAAGTG -3'
(R):5'- CAGAGAACGATCTTCAGGTAGC -3'
Posted On2014-08-25