Mutagenetix > Incidental Mutation

Incidental Mutation 'R2039:Hsp90aa1'

225449

Institutional Source

Beutler Lab

Gene Symbol

Hsp90aa1

Ensembl Gene

ENSMUSG00000021270

Gene Name

heat shock protein 90, alpha (cytosolic), class A member 1

Synonyms

hsp4, Hspca, Hsp90, Hsp86-1, Hsp89

MMRRC Submission

040046-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2039 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

110690605-110702728 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 110693782 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 360 (N360S)

Ref Sequence

ENSEMBL: ENSMUSP00000091921 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021698] [ENSMUST00000094361] [ENSMUST00000124156] [ENSMUST00000149189] [ENSMUST00000155242]

AlphaFold

P07901

Predicted Effect

probably damaging
Transcript: ENSMUST00000021698
AA Change: N360S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000021698
Gene: ENSMUSG00000021270
AA Change: N360S

Domain	Start	End	E-Value	Type
HATPase_c	40	194	2.94e-11	SMART
Pfam:HSP90	196	733	6.7e-272	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000094361
AA Change: N360S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000091921
Gene: ENSMUSG00000021270
AA Change: N360S

Domain	Start	End	E-Value	Type
HATPase_c	40	194	2.94e-11	SMART
Pfam:HSP90	196	728	2e-245	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000124156

SMART Domains

Protein: ENSMUSP00000121138
Gene: ENSMUSG00000021270

Domain	Start	End	E-Value	Type
PDB:3HHU\|B	1	103	1e-69	PDB
SCOP:d1byqa_	11	103	5e-48	SMART
Blast:HATPase_c	40	103	7e-39	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129005

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134967

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145255

Predicted Effect

probably benign
Transcript: ENSMUST00000149189

SMART Domains

Protein: ENSMUSP00000114201
Gene: ENSMUSG00000021270

Domain	Start	End	E-Value	Type
PDB:3HHU\|B	1	98	6e-66	PDB
SCOP:d1byqa_	11	98	2e-45	SMART
Blast:HATPase_c	40	98	2e-35	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000155242

SMART Domains

Protein: ENSMUSP00000118189
Gene: ENSMUSG00000021270

Domain	Start	End	E-Value	Type
HATPase_c	40	194	2.94e-11	SMART

Meta Mutation Damage Score

0.1862

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.9%

Validation Efficiency

96% (45/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an inducible molecular chaperone that functions as a homodimer. The encoded protein aids in the proper folding of specific target proteins by use of an ATPase activity that is modulated by co-chaperones. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit male sterility associated with arrested male meiosis and male germ cell apoptosis. Mice homozygous for a transgenic gene disruption exhibit male sterility and small testis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932415D10Rik	A	G	10: 82,284,676	S4167P	probably damaging	Het
4932438A13Rik	T	A	3: 37,003,878	F3206I	possibly damaging	Het
A2m	C	A	6: 121,659,949	T757K	probably benign	Het
Abca14	T	C	7: 120,312,264	V1357A	probably damaging	Het
Abca5	A	G	11: 110,299,929	F785S	probably damaging	Het
Arntl	T	G	7: 113,285,112	L119R	probably damaging	Het
Cacna1h	T	C	17: 25,391,845	I554V	probably benign	Het
Cuzd1	T	C	7: 131,309,616	S545G	probably benign	Het
Cuzd1	A	T	7: 131,314,914		probably benign	Het
Edrf1	T	A	7: 133,653,949	Y574*	probably null	Het
Eef1d	T	C	15: 75,895,769	D252G	probably damaging	Het
Efna5	T	G	17: 62,881,066	D22A	probably benign	Het
Esyt1	C	T	10: 128,511,951	V957I	probably benign	Het
Etl4	T	C	2: 20,785,228	S881P	probably damaging	Het
Exoc3	A	G	13: 74,192,977	I236T	probably benign	Het
Fam19a1	C	A	6: 96,654,764		probably null	Het
Far2	T	C	6: 148,165,577	L320S	probably benign	Het
Fsd1l	T	A	4: 53,679,972	D223E	probably benign	Het
Fut1	C	T	7: 45,618,991	A123V	possibly damaging	Het
Gap43	A	T	16: 42,292,352	D15E	possibly damaging	Het
Gm12789	T	C	4: 101,988,986		probably benign	Het
Gm5114	T	A	7: 39,409,188	T336S	probably damaging	Het
Hhla1	G	A	15: 65,936,377	T273I	possibly damaging	Het
Hira	A	G	16: 18,951,701	H812R	probably benign	Het
Kmt2c	A	G	5: 25,329,040	L1463S	possibly damaging	Het
Lman2l	A	G	1: 36,428,454	F171S	probably damaging	Het
Lrfn5	T	C	12: 61,840,323	L299S	possibly damaging	Het
Msr1	A	T	8: 39,589,377	W386R	probably damaging	Het
Myo1e	T	C	9: 70,320,133	V162A	possibly damaging	Het
Npy6r	A	G	18: 44,276,003	T164A	probably benign	Het
Olfr677	T	C	7: 105,056,390	L48P	possibly damaging	Het
Rbak	C	A	5: 143,173,175	V708L	probably benign	Het
Rev3l	A	G	10: 39,824,444	I1646V	probably damaging	Het
Rsrc1	A	G	3: 66,994,618	T34A	unknown	Het
Sept9	G	A	11: 117,351,617	V53I	probably damaging	Het
Snrnp200	G	A	2: 127,234,984	A1646T	probably benign	Het
Sqor	G	A	2: 122,792,404		probably null	Het
St7	T	C	6: 17,886,112	Y358H	probably damaging	Het
Tas2r126	T	A	6: 42,434,623	M30K	probably benign	Het
Thsd7a	G	A	6: 12,408,923	T700I	possibly damaging	Het
Ttn	T	G	2: 76,868,466		probably benign	Het
Ugt1a10	T	G	1: 88,055,981	I167S	probably benign	Het
Uhmk1	T	C	1: 170,212,267	D88G	probably damaging	Het
Washc2	T	A	6: 116,224,439	F332Y	probably damaging	Het
Wdr48	T	A	9: 119,909,387	W38R	probably damaging	Het
Zfc3h1	A	G	10: 115,406,483	D622G	probably damaging	Het

Other mutations in Hsp90aa1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02056:Hsp90aa1	APN	12	110694015	unclassified	probably benign
IGL02243:Hsp90aa1	APN	12	110695091	missense	probably damaging	1.00
IGL02865:Hsp90aa1	APN	12	110693082	missense	probably benign	0.11
IGL02965:Hsp90aa1	APN	12	110695679	start codon destroyed	probably null	0.95
R0827:Hsp90aa1	UTSW	12	110692695	missense	probably benign	0.38
R1331:Hsp90aa1	UTSW	12	110692820	missense	probably damaging	1.00
R1498:Hsp90aa1	UTSW	12	110695688	splice site	probably null
R2082:Hsp90aa1	UTSW	12	110692827	missense	probably damaging	1.00
R2102:Hsp90aa1	UTSW	12	110694132	missense	probably damaging	0.99
R2169:Hsp90aa1	UTSW	12	110692734	missense	probably damaging	0.99
R2194:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R2194:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R2359:Hsp90aa1	UTSW	12	110694569	critical splice donor site	probably null
R2364:Hsp90aa1	UTSW	12	110692753	missense	probably damaging	0.99
R2393:Hsp90aa1	UTSW	12	110693406	missense	probably damaging	1.00
R2398:Hsp90aa1	UTSW	12	110692321	missense	possibly damaging	0.86
R2435:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R2435:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R2924:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R2924:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R2925:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R2925:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3176:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3176:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3177:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3177:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3276:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3276:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3277:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3277:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3615:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3615:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3616:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3616:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R4033:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R4033:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R4815:Hsp90aa1	UTSW	12	110695226	missense	possibly damaging	0.45
R4932:Hsp90aa1	UTSW	12	110693717	missense	probably damaging	1.00
R5117:Hsp90aa1	UTSW	12	110695264	missense	possibly damaging	0.71
R5555:Hsp90aa1	UTSW	12	110692734	missense	probably damaging	1.00
R6382:Hsp90aa1	UTSW	12	110695517	critical splice donor site	probably null
R7024:Hsp90aa1	UTSW	12	110694112	missense	possibly damaging	0.46
R7324:Hsp90aa1	UTSW	12	110695225	missense	unknown
R7447:Hsp90aa1	UTSW	12	110692128	missense	possibly damaging	0.94
R7526:Hsp90aa1	UTSW	12	110695294	missense	unknown
R7732:Hsp90aa1	UTSW	12	110693418	missense	probably damaging	1.00
R8155:Hsp90aa1	UTSW	12	110695394	missense	unknown
R9004:Hsp90aa1	UTSW	12	110692611	missense	probably damaging	0.99
R9145:Hsp90aa1	UTSW	12	110696250	critical splice donor site	probably null
Z1177:Hsp90aa1	UTSW	12	110693466	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCCCTCTAATGAAATCTGGGG -3'
(R):5'- TCGAAGTGTAACTTAGCCCAG -3'

Sequencing Primer
(F):5'- TTTTTCCAAGGGGACTGAGCCC -3'
(R):5'- TCGAAGTGTAACTTAGCCCAGTAGAG -3'

Posted On

2014-08-25