Incidental Mutation 'R2039:St7'
ID 225401
Institutional Source Beutler Lab
Gene Symbol St7
Ensembl Gene ENSMUSG00000029534
Gene Name suppression of tumorigenicity 7
Synonyms RAY1, HELG, TSG7, Fam4a2, 9430001H04Rik, SEN4
MMRRC Submission 040046-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.155) question?
Stock # R2039 (G1)
Quality Score 167
Status Validated
Chromosome 6
Chromosomal Location 17693579-17943022 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 17886111 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 358 (Y358H)
Ref Sequence ENSEMBL: ENSMUSP00000111079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000674] [ENSMUST00000052113] [ENSMUST00000053148] [ENSMUST00000077080] [ENSMUST00000081635] [ENSMUST00000115417] [ENSMUST00000115420] [ENSMUST00000115418] [ENSMUST00000115419] [ENSMUST00000150281] [ENSMUST00000144488]
AlphaFold Q99M96
Predicted Effect probably damaging
Transcript: ENSMUST00000000674
AA Change: Y289H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000000674
Gene: ENSMUSG00000029534
AA Change: Y289H

DomainStartEndE-ValueType
Pfam:ST7 2 507 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000052113
AA Change: Y335H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000062886
Gene: ENSMUSG00000029534
AA Change: Y335H

DomainStartEndE-ValueType
Pfam:ST7 16 554 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000053148
AA Change: Y315H

PolyPhen 2 Score 0.469 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000057326
Gene: ENSMUSG00000029534
AA Change: Y315H

DomainStartEndE-ValueType
Pfam:ST7 3 534 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000077080
AA Change: Y312H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076334
Gene: ENSMUSG00000029534
AA Change: Y312H

DomainStartEndE-ValueType
Pfam:ST7 2 531 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000081635
AA Change: Y358H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000080341
Gene: ENSMUSG00000029534
AA Change: Y358H

DomainStartEndE-ValueType
Pfam:ST7 17 576 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115417
AA Change: Y292H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111077
Gene: ENSMUSG00000029534
AA Change: Y292H

DomainStartEndE-ValueType
Pfam:ST7 3 511 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115420
AA Change: Y335H

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000111080
Gene: ENSMUSG00000029534
AA Change: Y335H

DomainStartEndE-ValueType
Pfam:ST7 16 448 2.5e-278 PFAM
Pfam:ST7 445 523 2e-31 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115418
AA Change: Y335H

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000111078
Gene: ENSMUSG00000029534
AA Change: Y335H

DomainStartEndE-ValueType
Pfam:ST7 16 480 5e-278 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115419
AA Change: Y358H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111079
Gene: ENSMUSG00000029534
AA Change: Y358H

DomainStartEndE-ValueType
Pfam:ST7 16 572 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154497
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138726
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144743
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154059
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140358
Predicted Effect probably benign
Transcript: ENSMUST00000150281
SMART Domains Protein: ENSMUSP00000116304
Gene: ENSMUSG00000029534

DomainStartEndE-ValueType
Pfam:ST7 16 58 1.9e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144488
SMART Domains Protein: ENSMUSP00000115215
Gene: ENSMUSG00000029534

DomainStartEndE-ValueType
Pfam:ST7 16 82 6.3e-33 PFAM
Meta Mutation Damage Score 0.5491 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 96% (45/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene for this product maps to a region on chromosome 7 identified as an autism-susceptibility locus. Mutation screening of the entire coding region in autistic individuals failed to identify phenotype-specific variants, suggesting that coding mutations for this gene are unlikely to be involved in the etiology of autism. The function of this gene product has not been determined. Transcript variants encoding different isoforms of this protein have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m C A 6: 121,636,908 (GRCm39) T757K probably benign Het
Abca14 T C 7: 119,911,487 (GRCm39) V1357A probably damaging Het
Abca5 A G 11: 110,190,755 (GRCm39) F785S probably damaging Het
Bltp1 T A 3: 37,058,027 (GRCm39) F3206I possibly damaging Het
Bmal1 T G 7: 112,884,319 (GRCm39) L119R probably damaging Het
Cacna1h T C 17: 25,610,819 (GRCm39) I554V probably benign Het
Cuzd1 A T 7: 130,916,643 (GRCm39) probably benign Het
Cuzd1 T C 7: 130,911,345 (GRCm39) S545G probably benign Het
Edrf1 T A 7: 133,255,678 (GRCm39) Y574* probably null Het
Eef1d T C 15: 75,767,618 (GRCm39) D252G probably damaging Het
Efna5 T G 17: 63,188,061 (GRCm39) D22A probably benign Het
Esyt1 C T 10: 128,347,820 (GRCm39) V957I probably benign Het
Etl4 T C 2: 20,790,039 (GRCm39) S881P probably damaging Het
Exoc3 A G 13: 74,341,096 (GRCm39) I236T probably benign Het
Far2 T C 6: 148,067,075 (GRCm39) L320S probably benign Het
Fsd1l T A 4: 53,679,972 (GRCm39) D223E probably benign Het
Fut1 C T 7: 45,268,415 (GRCm39) A123V possibly damaging Het
Gap43 A T 16: 42,112,715 (GRCm39) D15E possibly damaging Het
Gm12789 T C 4: 101,846,183 (GRCm39) probably benign Het
Gm5114 T A 7: 39,058,612 (GRCm39) T336S probably damaging Het
Hhla1 G A 15: 65,808,226 (GRCm39) T273I possibly damaging Het
Hira A G 16: 18,770,451 (GRCm39) H812R probably benign Het
Hsp90aa1 T C 12: 110,660,216 (GRCm39) N360S probably damaging Het
Kmt2c A G 5: 25,534,038 (GRCm39) L1463S possibly damaging Het
Lman2l A G 1: 36,467,535 (GRCm39) F171S probably damaging Het
Lrfn5 T C 12: 61,887,109 (GRCm39) L299S possibly damaging Het
Msr1 A T 8: 40,042,418 (GRCm39) W386R probably damaging Het
Myo1e T C 9: 70,227,415 (GRCm39) V162A possibly damaging Het
Npy6r A G 18: 44,409,070 (GRCm39) T164A probably benign Het
Or52e4 T C 7: 104,705,597 (GRCm39) L48P possibly damaging Het
Rbak C A 5: 143,158,930 (GRCm39) V708L probably benign Het
Rev3l A G 10: 39,700,440 (GRCm39) I1646V probably damaging Het
Rsrc1 A G 3: 66,901,951 (GRCm39) T34A unknown Het
Septin9 G A 11: 117,242,443 (GRCm39) V53I probably damaging Het
Snrnp200 G A 2: 127,076,904 (GRCm39) A1646T probably benign Het
Spata31h1 A G 10: 82,120,510 (GRCm39) S4167P probably damaging Het
Sqor G A 2: 122,634,324 (GRCm39) probably null Het
Tafa1 C A 6: 96,631,725 (GRCm39) probably null Het
Tas2r126 T A 6: 42,411,557 (GRCm39) M30K probably benign Het
Thsd7a G A 6: 12,408,922 (GRCm39) T700I possibly damaging Het
Ttn T G 2: 76,698,810 (GRCm39) probably benign Het
Ugt1a10 T G 1: 87,983,703 (GRCm39) I167S probably benign Het
Uhmk1 T C 1: 170,039,836 (GRCm39) D88G probably damaging Het
Washc2 T A 6: 116,201,400 (GRCm39) F332Y probably damaging Het
Wdr48 T A 9: 119,738,453 (GRCm39) W38R probably damaging Het
Zfc3h1 A G 10: 115,242,388 (GRCm39) D622G probably damaging Het
Other mutations in St7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:St7 APN 6 17,855,005 (GRCm39) missense probably damaging 1.00
IGL01312:St7 APN 6 17,922,013 (GRCm39) missense probably damaging 1.00
IGL01562:St7 APN 6 17,922,034 (GRCm39) missense probably damaging 0.99
IGL01935:St7 APN 6 17,930,822 (GRCm39) missense probably damaging 0.99
IGL02127:St7 APN 6 17,844,968 (GRCm39) intron probably benign
IGL02954:St7 APN 6 17,848,030 (GRCm39) missense probably damaging 1.00
IGL02980:St7 UTSW 6 17,749,545 (GRCm39) intron probably benign
R0457:St7 UTSW 6 17,819,281 (GRCm39) missense probably damaging 1.00
R0666:St7 UTSW 6 17,934,238 (GRCm39) missense probably damaging 1.00
R0680:St7 UTSW 6 17,942,732 (GRCm39) missense probably damaging 0.99
R1575:St7 UTSW 6 17,886,110 (GRCm39) missense probably damaging 1.00
R2144:St7 UTSW 6 17,886,006 (GRCm39) missense possibly damaging 0.58
R2194:St7 UTSW 6 17,942,718 (GRCm39) missense probably damaging 1.00
R2869:St7 UTSW 6 17,819,276 (GRCm39) missense probably damaging 1.00
R2869:St7 UTSW 6 17,819,276 (GRCm39) missense probably damaging 1.00
R2873:St7 UTSW 6 17,819,276 (GRCm39) missense probably damaging 1.00
R2874:St7 UTSW 6 17,819,276 (GRCm39) missense probably damaging 1.00
R2970:St7 UTSW 6 17,844,908 (GRCm39) missense probably damaging 1.00
R3076:St7 UTSW 6 17,846,237 (GRCm39) nonsense probably null
R3921:St7 UTSW 6 17,846,244 (GRCm39) missense probably benign 0.31
R4326:St7 UTSW 6 17,819,287 (GRCm39) missense probably damaging 1.00
R4327:St7 UTSW 6 17,819,287 (GRCm39) missense probably damaging 1.00
R4410:St7 UTSW 6 17,854,932 (GRCm39) nonsense probably null
R4732:St7 UTSW 6 17,906,515 (GRCm39) splice site probably null
R4733:St7 UTSW 6 17,906,515 (GRCm39) splice site probably null
R4868:St7 UTSW 6 17,819,265 (GRCm39) missense probably damaging 1.00
R4988:St7 UTSW 6 17,934,225 (GRCm39) missense probably damaging 0.99
R5132:St7 UTSW 6 17,854,956 (GRCm39) missense probably damaging 0.97
R5182:St7 UTSW 6 17,846,236 (GRCm39) missense probably damaging 0.99
R5195:St7 UTSW 6 17,743,636 (GRCm39) intron probably benign
R5358:St7 UTSW 6 17,819,317 (GRCm39) missense probably damaging 1.00
R5502:St7 UTSW 6 17,834,673 (GRCm39) missense possibly damaging 0.94
R5882:St7 UTSW 6 17,846,248 (GRCm39) missense probably damaging 1.00
R5976:St7 UTSW 6 17,694,221 (GRCm39) missense possibly damaging 0.93
R6049:St7 UTSW 6 17,694,347 (GRCm39) missense possibly damaging 0.92
R6139:St7 UTSW 6 17,694,353 (GRCm39) missense probably damaging 1.00
R6177:St7 UTSW 6 17,819,333 (GRCm39) critical splice donor site probably null
R6181:St7 UTSW 6 17,694,363 (GRCm39) critical splice donor site probably null
R6401:St7 UTSW 6 17,855,317 (GRCm39) splice site probably null
R6546:St7 UTSW 6 17,852,313 (GRCm39) missense probably damaging 1.00
R6711:St7 UTSW 6 17,848,069 (GRCm39) missense possibly damaging 0.82
R6898:St7 UTSW 6 17,854,945 (GRCm39) missense probably damaging 1.00
R7536:St7 UTSW 6 17,886,019 (GRCm39) missense probably damaging 0.99
R7583:St7 UTSW 6 17,942,753 (GRCm39) missense possibly damaging 0.54
R7626:St7 UTSW 6 17,934,216 (GRCm39) missense probably damaging 1.00
R7718:St7 UTSW 6 17,854,998 (GRCm39) missense probably damaging 0.99
R7943:St7 UTSW 6 17,844,911 (GRCm39) missense probably damaging 1.00
R8334:St7 UTSW 6 17,934,220 (GRCm39) missense probably damaging 1.00
R8415:St7 UTSW 6 17,848,080 (GRCm39) critical splice donor site probably null
R9018:St7 UTSW 6 17,906,494 (GRCm39) missense probably damaging 1.00
R9217:St7 UTSW 6 17,846,271 (GRCm39) missense probably damaging 0.98
R9294:St7 UTSW 6 17,844,913 (GRCm39) nonsense probably null
Z1176:St7 UTSW 6 17,848,044 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCCAGACATCAGTTTCTGG -3'
(R):5'- GCACTACACTGAAGATGCTGG -3'

Sequencing Primer
(F):5'- GTGTCAAGCACTTTACTGACAGC -3'
(R):5'- TGCTGGAGAGTAACCATCGG -3'
Posted On 2014-08-25