Incidental Mutation 'R2039:St7'
ID 225401
Institutional Source Beutler Lab
Gene Symbol St7
Ensembl Gene ENSMUSG00000029534
Gene Name suppression of tumorigenicity 7
Synonyms RAY1, SEN4, Fam4a2, TSG7, 9430001H04Rik, HELG
MMRRC Submission 040046-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock # R2039 (G1)
Quality Score 167
Status Validated
Chromosome 6
Chromosomal Location 17692933-17943025 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 17886112 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 358 (Y358H)
Ref Sequence ENSEMBL: ENSMUSP00000111079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000674] [ENSMUST00000052113] [ENSMUST00000053148] [ENSMUST00000077080] [ENSMUST00000081635] [ENSMUST00000115417] [ENSMUST00000115418] [ENSMUST00000115419] [ENSMUST00000115420] [ENSMUST00000144488] [ENSMUST00000150281]
AlphaFold Q99M96
Predicted Effect probably damaging
Transcript: ENSMUST00000000674
AA Change: Y289H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000000674
Gene: ENSMUSG00000029534
AA Change: Y289H

DomainStartEndE-ValueType
Pfam:ST7 2 507 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000052113
AA Change: Y335H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000062886
Gene: ENSMUSG00000029534
AA Change: Y335H

DomainStartEndE-ValueType
Pfam:ST7 16 554 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000053148
AA Change: Y315H

PolyPhen 2 Score 0.469 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000057326
Gene: ENSMUSG00000029534
AA Change: Y315H

DomainStartEndE-ValueType
Pfam:ST7 3 534 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000077080
AA Change: Y312H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076334
Gene: ENSMUSG00000029534
AA Change: Y312H

DomainStartEndE-ValueType
Pfam:ST7 2 531 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000081635
AA Change: Y358H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000080341
Gene: ENSMUSG00000029534
AA Change: Y358H

DomainStartEndE-ValueType
Pfam:ST7 17 576 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115417
AA Change: Y292H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111077
Gene: ENSMUSG00000029534
AA Change: Y292H

DomainStartEndE-ValueType
Pfam:ST7 3 511 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115418
AA Change: Y335H

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000111078
Gene: ENSMUSG00000029534
AA Change: Y335H

DomainStartEndE-ValueType
Pfam:ST7 16 480 5e-278 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115419
AA Change: Y358H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111079
Gene: ENSMUSG00000029534
AA Change: Y358H

DomainStartEndE-ValueType
Pfam:ST7 16 572 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115420
AA Change: Y335H

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000111080
Gene: ENSMUSG00000029534
AA Change: Y335H

DomainStartEndE-ValueType
Pfam:ST7 16 448 2.5e-278 PFAM
Pfam:ST7 445 523 2e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138726
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140358
Predicted Effect probably benign
Transcript: ENSMUST00000144488
SMART Domains Protein: ENSMUSP00000115215
Gene: ENSMUSG00000029534

DomainStartEndE-ValueType
Pfam:ST7 16 82 6.3e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154497
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144743
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154059
Predicted Effect probably benign
Transcript: ENSMUST00000150281
SMART Domains Protein: ENSMUSP00000116304
Gene: ENSMUSG00000029534

DomainStartEndE-ValueType
Pfam:ST7 16 58 1.9e-15 PFAM
Meta Mutation Damage Score 0.5491 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 96% (45/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene for this product maps to a region on chromosome 7 identified as an autism-susceptibility locus. Mutation screening of the entire coding region in autistic individuals failed to identify phenotype-specific variants, suggesting that coding mutations for this gene are unlikely to be involved in the etiology of autism. The function of this gene product has not been determined. Transcript variants encoding different isoforms of this protein have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,284,676 S4167P probably damaging Het
4932438A13Rik T A 3: 37,003,878 F3206I possibly damaging Het
A2m C A 6: 121,659,949 T757K probably benign Het
Abca14 T C 7: 120,312,264 V1357A probably damaging Het
Abca5 A G 11: 110,299,929 F785S probably damaging Het
Arntl T G 7: 113,285,112 L119R probably damaging Het
Cacna1h T C 17: 25,391,845 I554V probably benign Het
Cuzd1 T C 7: 131,309,616 S545G probably benign Het
Cuzd1 A T 7: 131,314,914 probably benign Het
Edrf1 T A 7: 133,653,949 Y574* probably null Het
Eef1d T C 15: 75,895,769 D252G probably damaging Het
Efna5 T G 17: 62,881,066 D22A probably benign Het
Esyt1 C T 10: 128,511,951 V957I probably benign Het
Etl4 T C 2: 20,785,228 S881P probably damaging Het
Exoc3 A G 13: 74,192,977 I236T probably benign Het
Fam19a1 C A 6: 96,654,764 probably null Het
Far2 T C 6: 148,165,577 L320S probably benign Het
Fsd1l T A 4: 53,679,972 D223E probably benign Het
Fut1 C T 7: 45,618,991 A123V possibly damaging Het
Gap43 A T 16: 42,292,352 D15E possibly damaging Het
Gm12789 T C 4: 101,988,986 probably benign Het
Gm5114 T A 7: 39,409,188 T336S probably damaging Het
Hhla1 G A 15: 65,936,377 T273I possibly damaging Het
Hira A G 16: 18,951,701 H812R probably benign Het
Hsp90aa1 T C 12: 110,693,782 N360S probably damaging Het
Kmt2c A G 5: 25,329,040 L1463S possibly damaging Het
Lman2l A G 1: 36,428,454 F171S probably damaging Het
Lrfn5 T C 12: 61,840,323 L299S possibly damaging Het
Msr1 A T 8: 39,589,377 W386R probably damaging Het
Myo1e T C 9: 70,320,133 V162A possibly damaging Het
Npy6r A G 18: 44,276,003 T164A probably benign Het
Olfr677 T C 7: 105,056,390 L48P possibly damaging Het
Rbak C A 5: 143,173,175 V708L probably benign Het
Rev3l A G 10: 39,824,444 I1646V probably damaging Het
Rsrc1 A G 3: 66,994,618 T34A unknown Het
Sept9 G A 11: 117,351,617 V53I probably damaging Het
Snrnp200 G A 2: 127,234,984 A1646T probably benign Het
Sqor G A 2: 122,792,404 probably null Het
Tas2r126 T A 6: 42,434,623 M30K probably benign Het
Thsd7a G A 6: 12,408,923 T700I possibly damaging Het
Ttn T G 2: 76,868,466 probably benign Het
Ugt1a10 T G 1: 88,055,981 I167S probably benign Het
Uhmk1 T C 1: 170,212,267 D88G probably damaging Het
Washc2 T A 6: 116,224,439 F332Y probably damaging Het
Wdr48 T A 9: 119,909,387 W38R probably damaging Het
Zfc3h1 A G 10: 115,406,483 D622G probably damaging Het
Other mutations in St7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:St7 APN 6 17855006 missense probably damaging 1.00
IGL01312:St7 APN 6 17922014 missense probably damaging 1.00
IGL01562:St7 APN 6 17922035 missense probably damaging 0.99
IGL01935:St7 APN 6 17930823 missense probably damaging 0.99
IGL02127:St7 APN 6 17844969 intron probably benign
IGL02954:St7 APN 6 17848031 missense probably damaging 1.00
IGL02980:St7 UTSW 6 17749546 intron probably benign
R0457:St7 UTSW 6 17819282 missense probably damaging 1.00
R0666:St7 UTSW 6 17934239 missense probably damaging 1.00
R0680:St7 UTSW 6 17942733 missense probably damaging 0.99
R1575:St7 UTSW 6 17886111 missense probably damaging 1.00
R2144:St7 UTSW 6 17886007 missense possibly damaging 0.58
R2194:St7 UTSW 6 17942719 missense probably damaging 1.00
R2869:St7 UTSW 6 17819277 missense probably damaging 1.00
R2869:St7 UTSW 6 17819277 missense probably damaging 1.00
R2873:St7 UTSW 6 17819277 missense probably damaging 1.00
R2874:St7 UTSW 6 17819277 missense probably damaging 1.00
R2970:St7 UTSW 6 17844909 missense probably damaging 1.00
R3076:St7 UTSW 6 17846238 nonsense probably null
R3921:St7 UTSW 6 17846245 missense probably benign 0.31
R4326:St7 UTSW 6 17819288 missense probably damaging 1.00
R4327:St7 UTSW 6 17819288 missense probably damaging 1.00
R4410:St7 UTSW 6 17854933 nonsense probably null
R4732:St7 UTSW 6 17906516 splice site probably null
R4733:St7 UTSW 6 17906516 splice site probably null
R4868:St7 UTSW 6 17819266 missense probably damaging 1.00
R4988:St7 UTSW 6 17934226 missense probably damaging 0.99
R5132:St7 UTSW 6 17854957 missense probably damaging 0.97
R5182:St7 UTSW 6 17846237 missense probably damaging 0.99
R5195:St7 UTSW 6 17743637 intron probably benign
R5358:St7 UTSW 6 17819318 missense probably damaging 1.00
R5502:St7 UTSW 6 17834674 missense possibly damaging 0.94
R5882:St7 UTSW 6 17846249 missense probably damaging 1.00
R5976:St7 UTSW 6 17694222 missense possibly damaging 0.93
R6049:St7 UTSW 6 17694348 missense possibly damaging 0.92
R6139:St7 UTSW 6 17694354 missense probably damaging 1.00
R6177:St7 UTSW 6 17819334 critical splice donor site probably null
R6181:St7 UTSW 6 17694364 critical splice donor site probably null
R6401:St7 UTSW 6 17855318 splice site probably null
R6546:St7 UTSW 6 17852314 missense probably damaging 1.00
R6711:St7 UTSW 6 17848070 missense possibly damaging 0.82
R6898:St7 UTSW 6 17854946 missense probably damaging 1.00
R7536:St7 UTSW 6 17886020 missense probably damaging 0.99
R7583:St7 UTSW 6 17942754 missense possibly damaging 0.54
R7626:St7 UTSW 6 17934217 missense probably damaging 1.00
R7718:St7 UTSW 6 17854999 missense probably damaging 0.99
R7943:St7 UTSW 6 17844912 missense probably damaging 1.00
R8334:St7 UTSW 6 17934221 missense probably damaging 1.00
R8415:St7 UTSW 6 17848081 critical splice donor site probably null
R9018:St7 UTSW 6 17906495 missense probably damaging 1.00
R9217:St7 UTSW 6 17846272 missense probably damaging 0.98
R9294:St7 UTSW 6 17844914 nonsense probably null
Z1176:St7 UTSW 6 17848045 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCCAGACATCAGTTTCTGG -3'
(R):5'- GCACTACACTGAAGATGCTGG -3'

Sequencing Primer
(F):5'- GTGTCAAGCACTTTACTGACAGC -3'
(R):5'- TGCTGGAGAGTAACCATCGG -3'
Posted On 2014-08-25