Incidental Mutation 'R2039:Edrf1'
ID 225427
Institutional Source Beutler Lab
Gene Symbol Edrf1
Ensembl Gene ENSMUSG00000039990
Gene Name erythroid differentiation regulatory factor 1
Synonyms 2700050L05Rik
MMRRC Submission 040046-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.637) question?
Stock # R2039 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 133637543-133672971 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 133653949 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 574 (Y574*)
Ref Sequence ENSEMBL: ENSMUSP00000115641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051169] [ENSMUST00000128901] [ENSMUST00000138370]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000051169
AA Change: Y608*
SMART Domains Protein: ENSMUSP00000059166
Gene: ENSMUSG00000039990
AA Change: Y608*

DomainStartEndE-ValueType
low complexity region 8 29 N/A INTRINSIC
low complexity region 116 128 N/A INTRINSIC
low complexity region 219 237 N/A INTRINSIC
low complexity region 254 264 N/A INTRINSIC
low complexity region 467 477 N/A INTRINSIC
low complexity region 529 549 N/A INTRINSIC
low complexity region 1171 1184 N/A INTRINSIC
low complexity region 1229 1237 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000128901
AA Change: Y574*
SMART Domains Protein: ENSMUSP00000115641
Gene: ENSMUSG00000039990
AA Change: Y574*

DomainStartEndE-ValueType
low complexity region 8 29 N/A INTRINSIC
low complexity region 116 128 N/A INTRINSIC
low complexity region 219 237 N/A INTRINSIC
low complexity region 254 264 N/A INTRINSIC
low complexity region 433 443 N/A INTRINSIC
low complexity region 495 515 N/A INTRINSIC
low complexity region 1137 1150 N/A INTRINSIC
low complexity region 1195 1203 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138370
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211072
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 96% (45/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene may play a role in erythroid cell differentiation. The encoded protein inhibits DNA binding of the erythroid transcription factor GATA-1 and may regulate the expression of alpha-globin and gamma-globin. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,284,676 S4167P probably damaging Het
4932438A13Rik T A 3: 37,003,878 F3206I possibly damaging Het
A2m C A 6: 121,659,949 T757K probably benign Het
Abca14 T C 7: 120,312,264 V1357A probably damaging Het
Abca5 A G 11: 110,299,929 F785S probably damaging Het
Arntl T G 7: 113,285,112 L119R probably damaging Het
Cacna1h T C 17: 25,391,845 I554V probably benign Het
Cuzd1 T C 7: 131,309,616 S545G probably benign Het
Cuzd1 A T 7: 131,314,914 probably benign Het
Eef1d T C 15: 75,895,769 D252G probably damaging Het
Efna5 T G 17: 62,881,066 D22A probably benign Het
Esyt1 C T 10: 128,511,951 V957I probably benign Het
Etl4 T C 2: 20,785,228 S881P probably damaging Het
Exoc3 A G 13: 74,192,977 I236T probably benign Het
Fam19a1 C A 6: 96,654,764 probably null Het
Far2 T C 6: 148,165,577 L320S probably benign Het
Fsd1l T A 4: 53,679,972 D223E probably benign Het
Fut1 C T 7: 45,618,991 A123V possibly damaging Het
Gap43 A T 16: 42,292,352 D15E possibly damaging Het
Gm12789 T C 4: 101,988,986 probably benign Het
Gm5114 T A 7: 39,409,188 T336S probably damaging Het
Hhla1 G A 15: 65,936,377 T273I possibly damaging Het
Hira A G 16: 18,951,701 H812R probably benign Het
Hsp90aa1 T C 12: 110,693,782 N360S probably damaging Het
Kmt2c A G 5: 25,329,040 L1463S possibly damaging Het
Lman2l A G 1: 36,428,454 F171S probably damaging Het
Lrfn5 T C 12: 61,840,323 L299S possibly damaging Het
Msr1 A T 8: 39,589,377 W386R probably damaging Het
Myo1e T C 9: 70,320,133 V162A possibly damaging Het
Npy6r A G 18: 44,276,003 T164A probably benign Het
Olfr677 T C 7: 105,056,390 L48P possibly damaging Het
Rbak C A 5: 143,173,175 V708L probably benign Het
Rev3l A G 10: 39,824,444 I1646V probably damaging Het
Rsrc1 A G 3: 66,994,618 T34A unknown Het
Sept9 G A 11: 117,351,617 V53I probably damaging Het
Snrnp200 G A 2: 127,234,984 A1646T probably benign Het
Sqor G A 2: 122,792,404 probably null Het
St7 T C 6: 17,886,112 Y358H probably damaging Het
Tas2r126 T A 6: 42,434,623 M30K probably benign Het
Thsd7a G A 6: 12,408,923 T700I possibly damaging Het
Ttn T G 2: 76,868,466 probably benign Het
Ugt1a10 T G 1: 88,055,981 I167S probably benign Het
Uhmk1 T C 1: 170,212,267 D88G probably damaging Het
Washc2 T A 6: 116,224,439 F332Y probably damaging Het
Wdr48 T A 9: 119,909,387 W38R probably damaging Het
Zfc3h1 A G 10: 115,406,483 D622G probably damaging Het
Other mutations in Edrf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01111:Edrf1 APN 7 133658553 nonsense probably null
IGL01637:Edrf1 APN 7 133650525 missense probably damaging 1.00
IGL01697:Edrf1 APN 7 133643730 missense probably benign 0.02
IGL01893:Edrf1 APN 7 133657102 missense probably benign 0.09
IGL02202:Edrf1 APN 7 133656970 missense probably benign 0.00
IGL02278:Edrf1 APN 7 133657000 missense probably benign 0.00
IGL02382:Edrf1 APN 7 133650615 splice site probably benign
IGL02743:Edrf1 APN 7 133656491 unclassified probably benign
R0265:Edrf1 UTSW 7 133657045 missense probably damaging 1.00
R0282:Edrf1 UTSW 7 133644022 missense probably benign 0.21
R1167:Edrf1 UTSW 7 133644066 missense probably benign 0.08
R1633:Edrf1 UTSW 7 133652140 missense probably damaging 1.00
R2060:Edrf1 UTSW 7 133657129 nonsense probably null
R2920:Edrf1 UTSW 7 133667572 missense probably benign 0.00
R4770:Edrf1 UTSW 7 133658610 missense probably damaging 0.99
R4887:Edrf1 UTSW 7 133658610 missense probably damaging 0.99
R4888:Edrf1 UTSW 7 133658610 missense probably damaging 0.99
R5135:Edrf1 UTSW 7 133651044 missense probably benign 0.03
R5156:Edrf1 UTSW 7 133660179 missense probably damaging 1.00
R5290:Edrf1 UTSW 7 133650566 missense probably damaging 0.98
R5342:Edrf1 UTSW 7 133651910 splice site probably null
R5416:Edrf1 UTSW 7 133641402 missense possibly damaging 0.52
R5450:Edrf1 UTSW 7 133658610 missense probably damaging 0.99
R5906:Edrf1 UTSW 7 133663415 missense probably benign
R6272:Edrf1 UTSW 7 133637808 start gained probably benign
R6275:Edrf1 UTSW 7 133667582 missense possibly damaging 0.60
R7144:Edrf1 UTSW 7 133637849 missense probably benign
R7244:Edrf1 UTSW 7 133654350 missense probably benign 0.01
R7716:Edrf1 UTSW 7 133643726 missense probably damaging 0.99
R8193:Edrf1 UTSW 7 133661877 missense possibly damaging 0.95
R8197:Edrf1 UTSW 7 133647359 missense probably benign 0.41
R8553:Edrf1 UTSW 7 133650318 missense possibly damaging 0.88
R8710:Edrf1 UTSW 7 133643766 missense probably damaging 1.00
R8839:Edrf1 UTSW 7 133653915 missense probably benign 0.00
R9035:Edrf1 UTSW 7 133643702 missense probably damaging 0.97
R9051:Edrf1 UTSW 7 133671478 missense probably benign 0.00
R9121:Edrf1 UTSW 7 133657041 frame shift probably null
R9396:Edrf1 UTSW 7 133660109 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- GGCTACACAGTCTTTTGTTAAGC -3'
(R):5'- ACAGCAGCATTTCTACCTCAG -3'

Sequencing Primer
(F):5'- GTTAAGCAAGATTTGAAACAGTGCTG -3'
(R):5'- GCAGCATTTCTACCTCAGATATTTAG -3'
Posted On 2014-08-25