Incidental Mutation 'R2081:Usp9y'
ID229529
Institutional Source Beutler Lab
Gene Symbol Usp9y
Ensembl Gene ENSMUSG00000069044
Gene Nameubiquitin specific peptidase 9, Y chromosome
SynonymsDffry, Fafl2
MMRRC Submission 040086-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R2081 (G1)
Quality Score222
Status Not validated
ChromosomeY
Chromosomal Location1298961-1459782 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 1381277 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 848 (I848N)
Ref Sequence ENSEMBL: ENSMUSP00000088727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091188]
Predicted Effect possibly damaging
Transcript: ENSMUST00000091188
AA Change: I848N

PolyPhen 2 Score 0.651 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000088727
Gene: ENSMUSG00000069044
AA Change: I848N

DomainStartEndE-ValueType
low complexity region 34 48 N/A INTRINSIC
low complexity region 286 301 N/A INTRINSIC
low complexity region 973 983 N/A INTRINSIC
low complexity region 1089 1100 N/A INTRINSIC
low complexity region 1352 1363 N/A INTRINSIC
Pfam:UCH 1558 1955 9.2e-53 PFAM
Pfam:UCH_1 1559 1909 4e-22 PFAM
low complexity region 1959 1971 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the peptidase C19 family. It encodes a protein that is similar to ubiquitin-specific proteases, which cleave the ubiquitin moiety from ubiquitin-fused precursors and ubiquitinylated proteins. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl6 A G 11: 54,320,259 T28A possibly damaging Het
Actl11 G A 9: 107,930,197 G573D probably benign Het
Adam39 T A 8: 40,826,842 *757K probably null Het
Agpat4 T C 17: 12,151,884 I38T possibly damaging Het
Akap2 G A 4: 57,855,927 E419K possibly damaging Het
Ap3d1 A C 10: 80,732,936 I36S probably damaging Het
Arhgap45 T C 10: 80,027,674 F784L probably damaging Het
Atp10b T A 11: 43,202,128 I430N probably damaging Het
Atrip T A 9: 109,072,739 probably null Het
C2cd4b G T 9: 67,760,577 R285L probably damaging Het
Camta1 T C 4: 151,144,242 E711G probably benign Het
Clcn6 T C 4: 148,011,068 Y685C probably damaging Het
Col18a1 T A 10: 77,054,185 D1447V probably damaging Het
Crispld1 T A 1: 17,762,179 V463D probably damaging Het
Crybg2 T G 4: 134,088,820 F1612V possibly damaging Het
Dclk1 T C 3: 55,521,925 probably null Het
Ddx46 G T 13: 55,674,016 V834L probably benign Het
Dnah10 A G 5: 124,774,981 D1734G possibly damaging Het
Dpep1 T C 8: 123,199,378 V152A probably damaging Het
Ect2l T C 10: 18,165,527 E301G probably damaging Het
Elf3 C T 1: 135,257,076 C124Y probably benign Het
Eno2 A G 6: 124,763,125 V316A probably damaging Het
Erap1 A G 13: 74,675,307 E820G possibly damaging Het
Evpl A T 11: 116,234,266 H123Q probably damaging Het
Fat2 T A 11: 55,309,677 Y857F possibly damaging Het
Fbrsl1 T A 5: 110,371,625 probably null Het
Fbxw7 A G 3: 84,974,513 D432G probably damaging Het
Flt1 A T 5: 147,639,422 L592Q probably damaging Het
Gm14496 T A 2: 182,000,479 C648S probably damaging Het
Gm5150 A T 3: 15,990,945 S39T probably benign Het
Gm5426 T C 10: 96,136,739 I46T possibly damaging Het
Gse1 C A 8: 120,566,480 P177Q probably damaging Het
Heatr4 G A 12: 83,980,322 R54W probably damaging Het
Hpgd C A 8: 56,307,642 Q125K probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Mast2 A T 4: 116,330,474 probably null Het
Mfsd11 A G 11: 116,861,555 T177A possibly damaging Het
Mlx T C 11: 101,087,431 S36P probably benign Het
Mlxipl T A 5: 135,113,638 V102D probably damaging Het
Mms22l T C 4: 24,536,150 Y540H probably damaging Het
Msc T C 1: 14,755,717 D11G probably benign Het
Muc4 C G 16: 32,752,220 S699R probably benign Het
Nckap1l T C 15: 103,497,454 S1106P probably damaging Het
Obscn T C 11: 59,034,182 E5703G possibly damaging Het
Olfr705 A G 7: 106,714,198 M161T probably benign Het
Pabpn1 A G 14: 54,895,658 K38E probably damaging Het
Padi3 A T 4: 140,798,979 L141Q probably damaging Het
Pde3b A G 7: 114,523,422 N742D probably benign Het
Pex1 T A 5: 3,624,132 probably null Het
Pkd2 T C 5: 104,460,211 V192A probably benign Het
Ppp6r2 T A 15: 89,282,129 M750K probably benign Het
Prdm15 A T 16: 97,803,780 Y783* probably null Het
Prox2 T A 12: 85,095,008 Q140H probably damaging Het
Psg27 A T 7: 18,556,958 I440K probably damaging Het
Pzp A G 6: 128,519,420 M283T probably benign Het
Sec23a G A 12: 58,998,281 Q192* probably null Het
Sh2b1 A G 7: 126,472,690 S108P possibly damaging Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Tkfc G A 19: 10,597,378 A166V probably damaging Het
Tomm70a T C 16: 57,140,758 V358A probably damaging Het
Trim47 A G 11: 116,106,413 F505S probably damaging Het
Tti2 T C 8: 31,151,309 F154L possibly damaging Het
Ubap2l C T 3: 90,038,964 G111D possibly damaging Het
Veph1 T C 3: 66,061,102 Y740C probably damaging Het
Vmn2r114 T A 17: 23,291,109 H799L possibly damaging Het
Wdr31 T A 4: 62,455,943 M270L probably benign Het
Zfp26 A G 9: 20,436,617 S884P probably benign Het
Zswim6 T A 13: 107,773,395 noncoding transcript Het
Other mutations in Usp9y
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4466001:Usp9y UTSW Y 1432197 missense probably damaging 0.96
R0288:Usp9y UTSW Y 1333606 splice site probably benign
R0365:Usp9y UTSW Y 1364732 missense probably damaging 1.00
R0386:Usp9y UTSW Y 1316933 missense probably damaging 1.00
R0395:Usp9y UTSW Y 1340053 missense probably damaging 1.00
R0518:Usp9y UTSW Y 1307880 missense probably benign
R0521:Usp9y UTSW Y 1307880 missense probably benign
R0530:Usp9y UTSW Y 1333600 splice site probably benign
R0759:Usp9y UTSW Y 1299097 missense probably damaging 0.99
R0849:Usp9y UTSW Y 1394002 missense probably damaging 1.00
R0932:Usp9y UTSW Y 1315930 missense probably benign 0.37
R1018:Usp9y UTSW Y 1341414 splice site probably benign
R1208:Usp9y UTSW Y 1356282 missense probably benign
R1208:Usp9y UTSW Y 1356282 missense probably benign
R1470:Usp9y UTSW Y 1332471 missense probably benign 0.19
R1470:Usp9y UTSW Y 1332471 missense probably benign 0.19
R1730:Usp9y UTSW Y 1367093 missense probably benign 0.18
R1743:Usp9y UTSW Y 1316727 missense probably damaging 1.00
R1765:Usp9y UTSW Y 1384454 missense possibly damaging 0.88
R1775:Usp9y UTSW Y 1368089 missense probably damaging 1.00
R1783:Usp9y UTSW Y 1367093 missense probably benign 0.18
R1889:Usp9y UTSW Y 1448829 intron probably null
R1901:Usp9y UTSW Y 1303371 critical splice donor site probably null
R2119:Usp9y UTSW Y 1303451 missense probably benign 0.00
R2357:Usp9y UTSW Y 1394050 missense possibly damaging 0.87
R2873:Usp9y UTSW Y 1310502 splice site probably benign
R3938:Usp9y UTSW Y 1313741 missense probably damaging 0.97
R4323:Usp9y UTSW Y 1434407 missense possibly damaging 0.93
R4385:Usp9y UTSW Y 1304756 missense probably damaging 1.00
R4407:Usp9y UTSW Y 1336375 missense probably benign 0.16
R4457:Usp9y UTSW Y 1394078 missense possibly damaging 0.62
R4747:Usp9y UTSW Y 1391284 missense possibly damaging 0.64
R4823:Usp9y UTSW Y 1444559 missense probably damaging 0.99
R4834:Usp9y UTSW Y 1317002 missense probably benign 0.32
R4872:Usp9y UTSW Y 1307920 missense probably damaging 1.00
R4911:Usp9y UTSW Y 1308041 missense probably damaging 0.96
R4915:Usp9y UTSW Y 1316735 missense probably damaging 0.99
R4962:Usp9y UTSW Y 1384336 missense probably damaging 1.00
R5378:Usp9y UTSW Y 1315928 missense probably damaging 0.99
R5422:Usp9y UTSW Y 1314676 missense probably benign
R5432:Usp9y UTSW Y 1368022 splice site probably null
R5442:Usp9y UTSW Y 1336467 missense possibly damaging 0.80
R5469:Usp9y UTSW Y 1364714 missense probably benign 0.01
R5500:Usp9y UTSW Y 1341875 missense probably damaging 1.00
R5729:Usp9y UTSW Y 1381339 missense probably damaging 0.97
R5891:Usp9y UTSW Y 1341535 missense probably benign 0.05
R5920:Usp9y UTSW Y 1316730 missense probably damaging 1.00
R5948:Usp9y UTSW Y 1324996 missense possibly damaging 0.79
R6062:Usp9y UTSW Y 1454199 missense probably benign 0.28
R6265:Usp9y UTSW Y 1446843 missense probably benign 0.00
R6274:Usp9y UTSW Y 1316735 missense probably damaging 0.99
R6313:Usp9y UTSW Y 1385355 missense probably benign
R6330:Usp9y UTSW Y 1340123 missense probably benign 0.20
R6471:Usp9y UTSW Y 1384511 missense probably damaging 1.00
R6547:Usp9y UTSW Y 1444612 missense probably damaging 0.99
R6791:Usp9y UTSW Y 1325042 splice site probably null
R7194:Usp9y UTSW Y 1304672 missense probably damaging 1.00
R7341:Usp9y UTSW Y 1315759 intron probably null
R7357:Usp9y UTSW Y 1333656 missense possibly damaging 0.58
R7374:Usp9y UTSW Y 1381305 missense probably benign 0.00
R7404:Usp9y UTSW Y 1341780 missense probably benign 0.35
R7481:Usp9y UTSW Y 1432180 missense probably benign 0.08
R7584:Usp9y UTSW Y 1384451 missense probably damaging 1.00
R7697:Usp9y UTSW Y 1316990 missense possibly damaging 0.72
R7713:Usp9y UTSW Y 1304411 nonsense probably null
R7790:Usp9y UTSW Y 1444573 missense probably damaging 1.00
RF005:Usp9y UTSW Y 1435046 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- ACAGGGTAAAATGCATTAAAGTGTA -3'
(R):5'- GAATATTGAAGAGTTAGTGCTTGGT -3'

Sequencing Primer
(F):5'- AGTGTAAATAGTACTCACAGTTTGC -3'
(R):5'- AACTTTGTATGCCCCAGTACAGG -3'
Posted On2014-09-17