Incidental Mutation 'R2099:Aga'
ID233242
Institutional Source Beutler Lab
Gene Symbol Aga
Ensembl Gene ENSMUSG00000031521
Gene Nameaspartylglucosaminidase
Synonyms
MMRRC Submission 040103-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2099 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location53511727-53523421 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 53521131 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 286 (Y286*)
Ref Sequence ENSEMBL: ENSMUSP00000148133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033920] [ENSMUST00000209811] [ENSMUST00000211424]
Predicted Effect probably null
Transcript: ENSMUST00000033920
AA Change: Y296*
SMART Domains Protein: ENSMUSP00000033920
Gene: ENSMUSG00000031521
AA Change: Y296*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Asparaginase_2 32 333 2.5e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209811
Predicted Effect probably null
Transcript: ENSMUST00000211424
AA Change: Y286*
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an amidase enzyme that participates in the breakdown of glycoproteins in the cell. The encoded protein undergoes proteolytic processing to generate a mature enzyme. Mice lacking the encoded protein exhibit accumulation of aspartylglucosamine along with lysosomal vacuolization, axonal swelling in the gracile nucleus and impaired neuromotor coordination. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate mature protein. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate this gene die prematurely and share most of the clinical, biochemical and histopathological characteristics of human aspartylglycosaminuria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 G A 17: 45,506,894 R14Q unknown Het
Anks1 T C 17: 27,978,491 probably null Het
Arih2 A T 9: 108,616,738 F159I probably damaging Het
Asxl1 A T 2: 153,352,267 M46L possibly damaging Het
Atp23 G T 10: 126,891,726 probably null Het
Carmil1 T A 13: 24,173,667 L66F probably benign Het
Chd9 C T 8: 91,033,987 P2120L probably benign Het
Cramp1l A G 17: 24,973,085 V1027A probably benign Het
Cx3cr1 G A 9: 120,052,273 A21V probably benign Het
D3Ertd254e C T 3: 36,164,212 T128I possibly damaging Het
Dcxr A G 11: 120,725,577 F221S probably damaging Het
Dio2 T C 12: 90,729,823 *130W probably null Het
Dnah2 T C 11: 69,493,237 D1051G probably damaging Het
Ehbp1l1 T C 19: 5,718,401 E958G possibly damaging Het
Eif3a C A 19: 60,764,113 probably benign Het
Ephb2 T C 4: 136,660,755 D678G probably damaging Het
Fam109a C T 5: 121,853,286 P237L possibly damaging Het
Fpr3 G T 17: 17,971,181 R238L probably damaging Het
Frem3 A G 8: 80,615,859 S1594G probably benign Het
Gbp4 A C 5: 105,121,081 L402W probably damaging Het
Gdpd5 T A 7: 99,448,489 L164Q probably damaging Het
Il4i1 T C 7: 44,838,192 probably null Het
Kcp G T 6: 29,496,165 C723* probably null Het
Klhl18 A G 9: 110,455,418 F2L probably damaging Het
Lepr T A 4: 101,772,988 D633E probably damaging Het
Lifr A G 15: 7,157,251 I79V probably benign Het
Mcrs1 A G 15: 99,249,946 S27P probably benign Het
Mmp3 A G 9: 7,453,672 D431G probably benign Het
Mtor T A 4: 148,550,192 Y2423* probably null Het
Ndc80 A T 17: 71,504,778 D484E probably benign Het
Ndufb8 T A 19: 44,555,310 probably benign Het
Nmur2 A T 11: 56,040,763 S41T probably benign Het
Notch2 T C 3: 98,115,321 C819R possibly damaging Het
Olfr1303 A G 2: 111,813,832 I298T probably benign Het
Olfr781 A T 10: 129,333,283 N134I probably damaging Het
Olfr958 A G 9: 39,550,667 V68A probably benign Het
Phip T C 9: 82,915,339 H537R possibly damaging Het
Samd7 T C 3: 30,756,560 V242A probably benign Het
Sde2 T C 1: 180,866,148 L401P probably damaging Het
Slc20a1 A G 2: 129,207,838 D340G probably benign Het
Slc2a5 T A 4: 150,143,177 Y484* probably null Het
Spata31d1a A G 13: 59,706,071 L27P probably damaging Het
Sqstm1 T C 11: 50,202,984 T269A possibly damaging Het
Syne2 T C 12: 75,979,973 V3525A probably benign Het
Tctn1 G A 5: 122,242,709 P512L probably damaging Het
Tlr1 A G 5: 64,925,068 F722S probably damaging Het
Treh A G 9: 44,684,646 Y376C probably damaging Het
Trim47 T C 11: 116,106,344 N529S probably damaging Het
Trrap T C 5: 144,782,239 V184A possibly damaging Het
Tyrp1 T A 4: 80,835,379 N102K possibly damaging Het
Uspl1 T A 5: 149,214,758 S724T probably damaging Het
Vmn2r2 C A 3: 64,117,053 K702N probably damaging Het
Other mutations in Aga
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Aga APN 8 53518921 missense probably benign
IGL02581:Aga APN 8 53521044 splice site probably benign
IGL02617:Aga APN 8 53520313 missense possibly damaging 0.66
IGL03008:Aga APN 8 53511826 missense probably benign
R3747:Aga UTSW 8 53517821 missense probably benign
R4018:Aga UTSW 8 53523191 missense probably benign 0.00
R4247:Aga UTSW 8 53511830 missense possibly damaging 0.72
R4399:Aga UTSW 8 53511826 missense probably benign
R4421:Aga UTSW 8 53511826 missense probably benign
R4475:Aga UTSW 8 53511836 missense probably damaging 0.98
R5235:Aga UTSW 8 53514326 missense probably damaging 1.00
R5640:Aga UTSW 8 53511884 missense probably damaging 1.00
R7748:Aga UTSW 8 53511805 start codon destroyed possibly damaging 0.79
X0027:Aga UTSW 8 53521156 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTATTCACTCATAGGTATTATGCTCGG -3'
(R):5'- TGCACTCAGAAGCTGCCTAAC -3'

Sequencing Primer
(F):5'- ATGCTCGGTGTAAAAATATGGTTG -3'
(R):5'- TCAGAAGCTGCCTAACCTTTAC -3'
Posted On2014-09-18