Incidental Mutation 'R2167:Mapkap1'
List |< first << previous [record 26 of 56] next >> last >|
ID235520
Institutional Source Beutler Lab
Gene Symbol Mapkap1
Ensembl Gene ENSMUSG00000038696
Gene Namemitogen-activated protein kinase associated protein 1
SynonymsSin1, D230039K05Rik
MMRRC Submission 040170-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2167 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location34406771-34624950 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34597482 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 231 (F231L)
Ref Sequence ENSEMBL: ENSMUSP00000123301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113123] [ENSMUST00000113124] [ENSMUST00000113126] [ENSMUST00000124443] [ENSMUST00000147337]
Predicted Effect possibly damaging
Transcript: ENSMUST00000113123
AA Change: F231L

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108748
Gene: ENSMUSG00000038696
AA Change: F231L

DomainStartEndE-ValueType
Pfam:SIN1 1 289 2e-125 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113124
AA Change: F387L

PolyPhen 2 Score 0.121 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000108749
Gene: ENSMUSG00000038696
AA Change: F387L

DomainStartEndE-ValueType
Pfam:SIN1 18 324 4.7e-125 PFAM
Pfam:SIN1 318 445 2.1e-48 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113126
AA Change: F423L

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108751
Gene: ENSMUSG00000038696
AA Change: F423L

DomainStartEndE-ValueType
Pfam:SIN1 18 481 1.1e-188 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000124443
AA Change: F231L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123301
Gene: ENSMUSG00000038696
AA Change: F231L

DomainStartEndE-ValueType
Pfam:SIN1 1 289 1.6e-125 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000147337
AA Change: F423L

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000116494
Gene: ENSMUSG00000038696
AA Change: F423L

DomainStartEndE-ValueType
Pfam:SIN1 18 129 1.2e-32 PFAM
Pfam:CRIM 139 276 3.3e-38 PFAM
Pfam:SIN1_PH 381 488 3.4e-34 PFAM
Meta Mutation Damage Score 0.5232 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is highly similar to the yeast SIN1 protein, a stress-activated protein kinase. Alternatively spliced transcript variants encoding distinct isoforms have been described. Alternate polyadenylation sites as well as alternate 3' UTRs have been identified for transcripts of this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit embryonic lethality due to early developmental abnormalities. Mutant mouse embryonic fibroblasts display increased susceptibility to stress-induced apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 C T 11: 9,288,532 T710M probably benign Het
Acan A G 7: 79,099,957 E1492G probably benign Het
Acsl1 A G 8: 46,533,590 D638G possibly damaging Het
Acsl6 C A 11: 54,327,157 T207K probably benign Het
Ahnak A T 19: 9,011,494 K3381* probably null Het
Art1 T C 7: 102,106,824 V74A probably damaging Het
Bhmt2 A T 13: 93,662,504 W270R probably benign Het
Calm2 T C 17: 87,435,145 T118A probably benign Het
Ccdc88b G T 19: 6,854,084 Q497K possibly damaging Het
Ccne2 A T 4: 11,197,249 M183L probably benign Het
Cdc42bpg A G 19: 6,317,677 I1026V probably damaging Het
Celsr2 T C 3: 108,413,193 T768A probably damaging Het
Cog5 T C 12: 31,837,289 F470L probably damaging Het
Cpne5 T C 17: 29,162,332 D374G probably damaging Het
Disp2 A C 2: 118,791,685 E966A probably damaging Het
Dmrtc2 C T 7: 24,873,919 probably benign Het
Eif2b3 T A 4: 117,028,540 I93N probably damaging Het
Elfn2 C A 15: 78,672,446 V634L probably benign Het
Fasl T G 1: 161,787,138 S119R probably benign Het
Foxp2 C G 6: 15,437,902 P701A probably damaging Het
Helz T A 11: 107,672,964 probably benign Het
Kctd6 T C 14: 8,222,683 V175A probably benign Het
Leo1 A G 9: 75,445,709 N178S probably benign Het
Lhx6 C A 2: 36,103,359 R80L probably damaging Het
Man1a2 A G 3: 100,591,900 L406P probably damaging Het
Mknk2 A G 10: 80,668,701 Y256H probably damaging Het
Msh6 A G 17: 87,989,483 T1203A probably damaging Het
Nbeal2 T C 9: 110,638,308 Y604C probably damaging Het
Ncam1 G T 9: 49,568,481 Q66K probably benign Het
Nsd2 T A 5: 33,882,919 H933Q probably damaging Het
Olfr1341 T C 4: 118,710,055 V216A probably benign Het
Olfr1564 T A 17: 33,215,568 I262F probably damaging Het
Olfr191 T A 16: 59,085,586 K299I probably benign Het
Olfr709-ps1 A G 7: 106,926,590 Y290H probably damaging Het
Pappa A C 4: 65,156,445 D412A probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rassf6 C T 5: 90,603,938 E308K probably damaging Het
Rb1 T C 14: 73,211,651 T680A probably damaging Het
Rfpl4 T A 7: 5,110,853 I104F probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rnase6 A C 14: 51,130,517 D122A probably benign Het
Rsf1 GGCG GGCGACGGCAGCG 7: 97,579,906 probably benign Het
Sec31b G A 19: 44,543,353 T39I possibly damaging Het
Slc12a1 A G 2: 125,173,681 I385V probably damaging Het
Slc6a17 A T 3: 107,491,501 Y261* probably null Het
Supt6 G A 11: 78,208,167 P1626L possibly damaging Het
Tbx15 A G 3: 99,326,455 probably benign Het
Telo2 A G 17: 25,110,818 V240A probably benign Het
Trhr C T 15: 44,229,242 L292F probably damaging Het
Trps1 G A 15: 50,831,730 L340F possibly damaging Het
Ube2e1 T C 14: 18,284,429 probably benign Het
Yeats2 T C 16: 20,213,401 probably benign Het
Zbtb39 G A 10: 127,742,975 E473K probably benign Het
Zfp235 T A 7: 24,140,962 S269T possibly damaging Het
Zfp580 C A 7: 5,053,064 P141Q possibly damaging Het
Other mutations in Mapkap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01714:Mapkap1 APN 2 34518843 missense probably damaging 1.00
IGL02104:Mapkap1 APN 2 34623470 nonsense probably null
IGL02390:Mapkap1 APN 2 34432089 missense probably damaging 0.99
IGL02508:Mapkap1 APN 2 34518669 splice site probably benign
IGL02817:Mapkap1 APN 2 34563118 missense probably damaging 1.00
PIT4696001:Mapkap1 UTSW 2 34619849 missense probably damaging 0.96
R0129:Mapkap1 UTSW 2 34623482 missense probably damaging 1.00
R0480:Mapkap1 UTSW 2 34533781 splice site probably benign
R1966:Mapkap1 UTSW 2 34518679 missense probably damaging 0.98
R4432:Mapkap1 UTSW 2 34619863 missense probably damaging 1.00
R4789:Mapkap1 UTSW 2 34533847 missense possibly damaging 0.64
R4805:Mapkap1 UTSW 2 34597422 critical splice acceptor site probably null
R4806:Mapkap1 UTSW 2 34597422 critical splice acceptor site probably null
R4807:Mapkap1 UTSW 2 34597422 critical splice acceptor site probably null
R4808:Mapkap1 UTSW 2 34597422 critical splice acceptor site probably null
R4862:Mapkap1 UTSW 2 34623430 missense probably damaging 1.00
R4989:Mapkap1 UTSW 2 34581291 missense probably damaging 1.00
R5283:Mapkap1 UTSW 2 34444348 missense probably damaging 1.00
R6186:Mapkap1 UTSW 2 34563114 missense possibly damaging 0.76
R6248:Mapkap1 UTSW 2 34518680 missense probably damaging 1.00
R6891:Mapkap1 UTSW 2 34563141 missense probably damaging 1.00
R6985:Mapkap1 UTSW 2 34432110 missense probably damaging 1.00
R7078:Mapkap1 UTSW 2 34563139 missense probably damaging 1.00
R7179:Mapkap1 UTSW 2 34518700 missense possibly damaging 0.88
R7336:Mapkap1 UTSW 2 34533817 missense possibly damaging 0.51
R7392:Mapkap1 UTSW 2 34435154 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTGTTGGAAGAATCCCATG -3'
(R):5'- CTGGTAATGAATTAAACAGGCCCAAG -3'

Sequencing Primer
(F):5'- TGGAAGAATCCCATGTTCCCTGAAG -3'
(R):5'- TATATTCTGCCAGCGCCA -3'
Posted On2014-10-01