Incidental Mutation 'R0200:Cds1'
ID23554
Institutional Source Beutler Lab
Gene Symbol Cds1
Ensembl Gene ENSMUSG00000029330
Gene NameCDP-diacylglycerol synthase 1
Synonyms4833409J18Rik, phosphatidate cytidylyltransferase
MMRRC Submission 038457-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.195) question?
Stock #R0200 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location101765130-101823858 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 101814433 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 305 (V305M)
Ref Sequence ENSEMBL: ENSMUSP00000031273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031273]
Predicted Effect probably damaging
Transcript: ENSMUST00000031273
AA Change: V305M

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000031273
Gene: ENSMUSG00000029330
AA Change: V305M

DomainStartEndE-ValueType
low complexity region 7 29 N/A INTRINSIC
Pfam:CTP_transf_1 87 417 6.4e-89 PFAM
low complexity region 427 439 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132213
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200599
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.7%
  • 20x: 86.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Breakdown products of phosphoinositides are ubiquitous second messengers that function downstream of many G protein-coupled receptors and tyrosine kinases regulating cell growth, calcium metabolism, and protein kinase C activity. This gene encodes an enzyme which regulates the amount of phosphatidylinositol available for signaling by catalyzing the conversion of phosphatidic acid to CDP-diacylglycerol. This enzyme is an integral membrane protein localized to two subcellular domains, the matrix side of the inner mitochondrial membrane where it is thought to be involved in the synthesis of phosphatidylglycerol and cardiolipin and the cytoplasmic side of the endoplasmic reticulum where it functions in phosphatidylinositol biosynthesis. Two genes encoding this enzyme have been identified in humans, one mapping to human chromosome 4q21 and a second to 20p13. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730017C20Rik A G 18: 59,062,459 probably null Het
Aatf T C 11: 84,445,676 K466E probably damaging Het
Abcc3 T C 11: 94,355,074 D1245G probably damaging Het
Adam12 T C 7: 133,974,416 probably null Het
Akap11 A G 14: 78,510,753 V1398A probably benign Het
Ank1 T G 8: 23,096,812 L461R probably damaging Het
Ankfn1 T C 11: 89,441,966 S402G possibly damaging Het
Arhgef40 A C 14: 51,996,974 E911D probably damaging Het
Atp2b1 C T 10: 98,979,814 Q107* probably null Het
BC117090 T C 16: 36,323,024 probably null Het
Cacng3 T A 7: 122,671,785 C4* probably null Het
Ccdc129 T C 6: 55,897,956 L297P probably benign Het
Cecr2 T G 6: 120,761,797 F1162V probably damaging Het
Cfap70 A T 14: 20,448,563 Y19N probably damaging Het
Chrm5 A G 2: 112,480,720 V17A probably benign Het
Col20a1 T C 2: 181,000,438 I714T probably damaging Het
Cpeb2 T A 5: 43,261,776 M156K possibly damaging Het
Defb25 C A 2: 152,622,412 V71L probably benign Het
Dhx35 A T 2: 158,829,623 M325L probably benign Het
Dhx57 A T 17: 80,251,473 L1019H probably damaging Het
Dnah6 T A 6: 73,069,420 D3195V probably damaging Het
Dph5 A G 3: 115,928,703 S277G probably benign Het
Dpm1 C A 2: 168,223,155 probably null Het
Dsg1a A T 18: 20,340,938 M1023L probably benign Het
Egf A G 3: 129,706,233 Y252H probably benign Het
Egf A G 3: 129,737,549 S126P probably damaging Het
Enam T C 5: 88,493,027 W183R possibly damaging Het
Foxn1 T C 11: 78,361,040 Y455C probably damaging Het
Gm14085 T A 2: 122,527,447 *661R probably null Het
Iars A T 13: 49,726,202 D983V possibly damaging Het
Ikzf4 C A 10: 128,634,676 G325V probably damaging Het
Il1rl1 T A 1: 40,441,303 W31R possibly damaging Het
Ip6k3 C T 17: 27,145,025 D350N probably damaging Het
Irgc1 T C 7: 24,432,006 D462G probably benign Het
Jph3 A G 8: 121,784,833 E520G probably benign Het
Kcna2 T A 3: 107,105,160 D352E probably benign Het
Klk4 T A 7: 43,885,361 I248N probably damaging Het
Krtap16-1 T C 11: 99,985,297 Y427C probably damaging Het
Lgr4 A G 2: 109,970,690 probably null Het
Lhpp C T 7: 132,610,677 probably benign Het
Lypd3 T A 7: 24,640,231 V241D probably damaging Het
Lyz2 T A 10: 117,280,773 N57Y possibly damaging Het
Man1a A G 10: 54,074,498 V176A probably damaging Het
Mcm4 G A 16: 15,629,639 T487I probably benign Het
Mettl21c T A 1: 44,013,654 I68F probably damaging Het
Miip T A 4: 147,862,263 T313S probably damaging Het
Mog A T 17: 37,012,419 I209K probably damaging Het
Myo1c C A 11: 75,672,182 D997E probably benign Het
Npc1 T C 18: 12,219,204 Y146C probably damaging Het
Nploc4 A G 11: 120,413,681 L238P probably damaging Het
Olfr231 T C 1: 174,117,512 H168R probably benign Het
Olfr531 T C 7: 140,400,875 Y57C probably damaging Het
Olfr56 T A 11: 49,135,047 M285K probably damaging Het
Opa1 A G 16: 29,614,129 N544S probably benign Het
Pam C T 1: 97,894,401 probably null Het
Pdgfra T C 5: 75,163,777 Y98H probably damaging Het
Plcz1 C T 6: 139,990,733 R590H probably damaging Het
Plxdc1 T C 11: 97,934,012 Y339C probably damaging Het
Plxna1 T C 6: 89,323,593 N1583S probably damaging Het
Plxna4 C T 6: 32,197,088 V1191M probably damaging Het
Polk T A 13: 96,496,822 N238Y probably benign Het
Ptprq T C 10: 107,685,157 N718S probably benign Het
Rsrc1 A T 3: 67,180,861 H176L probably damaging Het
Sbno1 T C 5: 124,384,541 D1072G probably damaging Het
Scmh1 A G 4: 120,483,831 K238R probably damaging Het
Senp7 A G 16: 56,123,873 T187A possibly damaging Het
Slc12a4 T C 8: 105,951,617 R315G probably benign Het
Slc16a10 A G 10: 40,040,616 V430A probably benign Het
Slc26a7 T C 4: 14,621,317 D23G probably benign Het
Slc7a7 A G 14: 54,377,802 L246P probably damaging Het
Spata7 T A 12: 98,663,169 S332T probably benign Het
Spsb1 A G 4: 149,898,216 *274R probably null Het
Sspo T G 6: 48,486,415 V3767G probably null Het
Syt10 C A 15: 89,826,941 A130S probably benign Het
Tgm6 T A 2: 130,152,945 probably null Het
Them7 A C 2: 105,297,917 N81T probably damaging Het
Tinag C A 9: 76,951,935 A464S probably damaging Het
Tmem217 T G 17: 29,526,310 I149L probably benign Het
Trp53rkb T G 2: 166,795,683 D186E probably damaging Het
Vmn1r20 T C 6: 57,432,099 Y137H probably damaging Het
Vmn1r60 T A 7: 5,544,380 L240F probably benign Het
Vmn1r64 A G 7: 5,883,818 M242T probably benign Het
Xkr4 T C 1: 3,670,663 N229S probably benign Het
Zcchc2 T A 1: 106,004,123 L352M probably damaging Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zfp638 T C 6: 83,967,354 L1018P probably damaging Het
Other mutations in Cds1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Cds1 APN 5 101809901 missense probably damaging 0.99
IGL02052:Cds1 APN 5 101814472 missense probably benign 0.01
IGL02238:Cds1 APN 5 101814436 missense possibly damaging 0.84
IGL02449:Cds1 APN 5 101815928 missense probably damaging 1.00
IGL02833:Cds1 APN 5 101814466 missense possibly damaging 0.81
IGL02973:Cds1 APN 5 101812510 missense probably damaging 0.99
IGL02987:Cds1 APN 5 101812525 missense possibly damaging 0.85
R0076:Cds1 UTSW 5 101817840 splice site probably benign
R0285:Cds1 UTSW 5 101797038 missense probably damaging 1.00
R0608:Cds1 UTSW 5 101814433 missense probably damaging 0.97
R0932:Cds1 UTSW 5 101797025 missense probably damaging 0.99
R1444:Cds1 UTSW 5 101798379 missense probably damaging 1.00
R1585:Cds1 UTSW 5 101817962 splice site probably benign
R1781:Cds1 UTSW 5 101812550 missense possibly damaging 0.78
R2126:Cds1 UTSW 5 101812550 missense probably benign 0.34
R4804:Cds1 UTSW 5 101821523 missense probably damaging 1.00
R4990:Cds1 UTSW 5 101798379 missense probably damaging 1.00
R5176:Cds1 UTSW 5 101781420 missense possibly damaging 0.87
R5330:Cds1 UTSW 5 101798495 missense probably damaging 1.00
R5331:Cds1 UTSW 5 101798495 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTAAGACTGCATCAGCCCCGCC -3'
(R):5'- CCCTGGAACATTAACACCCCGTTTG -3'

Sequencing Primer
(F):5'- TGGAGATGTCATTCTCTAAAGGC -3'
(R):5'- CACCCCGTTTGATGATGTTTAAGAAG -3'
Posted On2013-04-16