Mutagenetix > Incidental Mutation

Incidental Mutation 'R0200:Dsg1a'

23617

Institutional Source

Beutler Lab

Gene Symbol

Dsg1a

Ensembl Gene

ENSMUSG00000069441

Gene Name

desmoglein 1 alpha

Synonyms

Dsg1

MMRRC Submission

038457-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.097) question?

Stock #

R0200 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

20310811-20343350 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 20340938 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 1023 (M1023L)

Ref Sequence

ENSEMBL: ENSMUSP00000076393 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077146]

AlphaFold

Q61495

Predicted Effect

probably benign
Transcript: ENSMUST00000077146
AA Change: M1023L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000076393
Gene: ENSMUSG00000069441
AA Change: M1023L

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
CA	70	155	3.45e-14	SMART
CA	179	267	3.11e-21	SMART
CA	290	384	6.29e-8	SMART
CA	407	485	6.44e-1	SMART
low complexity region	573	584	N/A	INTRINSIC
low complexity region	590	598	N/A	INTRINSIC
Pfam:Cadherin_C	659	781	1.6e-10	PFAM
low complexity region	786	799	N/A	INTRINSIC
internal_repeat_1	823	888	9.56e-6	PROSPERO
internal_repeat_1	908	975	9.56e-6	PROSPERO
low complexity region	983	1004	N/A	INTRINSIC

Coding Region Coverage

1x: 98.8%
3x: 97.8%
10x: 94.7%
20x: 86.2%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Jan 2016]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A730017C20Rik	A	G	18: 59,062,459		probably null	Het
Aatf	T	C	11: 84,445,676	K466E	probably damaging	Het
Abcc3	T	C	11: 94,355,074	D1245G	probably damaging	Het
Adam12	T	C	7: 133,974,416		probably null	Het
Akap11	A	G	14: 78,510,753	V1398A	probably benign	Het
Ank1	T	G	8: 23,096,812	L461R	probably damaging	Het
Ankfn1	T	C	11: 89,441,966	S402G	possibly damaging	Het
Arhgef40	A	C	14: 51,996,974	E911D	probably damaging	Het
Atp2b1	C	T	10: 98,979,814	Q107*	probably null	Het
BC117090	T	C	16: 36,323,024		probably null	Het
Cacng3	T	A	7: 122,671,785	C4*	probably null	Het
Ccdc129	T	C	6: 55,897,956	L297P	probably benign	Het
Cds1	G	A	5: 101,814,433	V305M	probably damaging	Het
Cecr2	T	G	6: 120,761,797	F1162V	probably damaging	Het
Cfap70	A	T	14: 20,448,563	Y19N	probably damaging	Het
Chrm5	A	G	2: 112,480,720	V17A	probably benign	Het
Col20a1	T	C	2: 181,000,438	I714T	probably damaging	Het
Cpeb2	T	A	5: 43,261,776	M156K	possibly damaging	Het
Defb25	C	A	2: 152,622,412	V71L	probably benign	Het
Dhx35	A	T	2: 158,829,623	M325L	probably benign	Het
Dhx57	A	T	17: 80,251,473	L1019H	probably damaging	Het
Dnah6	T	A	6: 73,069,420	D3195V	probably damaging	Het
Dph5	A	G	3: 115,928,703	S277G	probably benign	Het
Dpm1	C	A	2: 168,223,155		probably null	Het
Egf	A	G	3: 129,706,233	Y252H	probably benign	Het
Egf	A	G	3: 129,737,549	S126P	probably damaging	Het
Enam	T	C	5: 88,493,027	W183R	possibly damaging	Het
Foxn1	T	C	11: 78,361,040	Y455C	probably damaging	Het
Gm14085	T	A	2: 122,527,447	*661R	probably null	Het
Iars	A	T	13: 49,726,202	D983V	possibly damaging	Het
Ikzf4	C	A	10: 128,634,676	G325V	probably damaging	Het
Il1rl1	T	A	1: 40,441,303	W31R	possibly damaging	Het
Ip6k3	C	T	17: 27,145,025	D350N	probably damaging	Het
Irgc1	T	C	7: 24,432,006	D462G	probably benign	Het
Jph3	A	G	8: 121,784,833	E520G	probably benign	Het
Kcna2	T	A	3: 107,105,160	D352E	probably benign	Het
Klk4	T	A	7: 43,885,361	I248N	probably damaging	Het
Krtap16-1	T	C	11: 99,985,297	Y427C	probably damaging	Het
Lgr4	A	G	2: 109,970,690		probably null	Het
Lhpp	C	T	7: 132,610,677		probably benign	Het
Lypd3	T	A	7: 24,640,231	V241D	probably damaging	Het
Lyz2	T	A	10: 117,280,773	N57Y	possibly damaging	Het
Man1a	A	G	10: 54,074,498	V176A	probably damaging	Het
Mcm4	G	A	16: 15,629,639	T487I	probably benign	Het
Mettl21c	T	A	1: 44,013,654	I68F	probably damaging	Het
Miip	T	A	4: 147,862,263	T313S	probably damaging	Het
Mog	A	T	17: 37,012,419	I209K	probably damaging	Het
Myo1c	C	A	11: 75,672,182	D997E	probably benign	Het
Npc1	T	C	18: 12,219,204	Y146C	probably damaging	Het
Nploc4	A	G	11: 120,413,681	L238P	probably damaging	Het
Olfr231	T	C	1: 174,117,512	H168R	probably benign	Het
Olfr531	T	C	7: 140,400,875	Y57C	probably damaging	Het
Olfr56	T	A	11: 49,135,047	M285K	probably damaging	Het
Opa1	A	G	16: 29,614,129	N544S	probably benign	Het
Pam	C	T	1: 97,894,401		probably null	Het
Pdgfra	T	C	5: 75,163,777	Y98H	probably damaging	Het
Plcz1	C	T	6: 139,990,733	R590H	probably damaging	Het
Plxdc1	T	C	11: 97,934,012	Y339C	probably damaging	Het
Plxna1	T	C	6: 89,323,593	N1583S	probably damaging	Het
Plxna4	C	T	6: 32,197,088	V1191M	probably damaging	Het
Polk	T	A	13: 96,496,822	N238Y	probably benign	Het
Ptprq	T	C	10: 107,685,157	N718S	probably benign	Het
Rsrc1	A	T	3: 67,180,861	H176L	probably damaging	Het
Sbno1	T	C	5: 124,384,541	D1072G	probably damaging	Het
Scmh1	A	G	4: 120,483,831	K238R	probably damaging	Het
Senp7	A	G	16: 56,123,873	T187A	possibly damaging	Het
Slc12a4	T	C	8: 105,951,617	R315G	probably benign	Het
Slc16a10	A	G	10: 40,040,616	V430A	probably benign	Het
Slc26a7	T	C	4: 14,621,317	D23G	probably benign	Het
Slc7a7	A	G	14: 54,377,802	L246P	probably damaging	Het
Spata7	T	A	12: 98,663,169	S332T	probably benign	Het
Spsb1	A	G	4: 149,898,216	*274R	probably null	Het
Sspo	T	G	6: 48,486,415	V3767G	probably null	Het
Syt10	C	A	15: 89,826,941	A130S	probably benign	Het
Tgm6	T	A	2: 130,152,945		probably null	Het
Them7	A	C	2: 105,297,917	N81T	probably damaging	Het
Tinag	C	A	9: 76,951,935	A464S	probably damaging	Het
Tmem217	T	G	17: 29,526,310	I149L	probably benign	Het
Trp53rkb	T	G	2: 166,795,683	D186E	probably damaging	Het
Vmn1r20	T	C	6: 57,432,099	Y137H	probably damaging	Het
Vmn1r60	T	A	7: 5,544,380	L240F	probably benign	Het
Vmn1r64	A	G	7: 5,883,818	M242T	probably benign	Het
Xkr4	T	C	1: 3,670,663	N229S	probably benign	Het
Zcchc2	T	A	1: 106,004,123	L352M	probably damaging	Het
Zfp217	C	T	2: 170,115,462	A539T	probably benign	Het
Zfp638	T	C	6: 83,967,354	L1018P	probably damaging	Het

Other mutations in Dsg1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01064:Dsg1a	APN	18	20340206	missense	probably damaging	1.00
IGL01148:Dsg1a	APN	18	20320925	missense	probably damaging	0.97
IGL01534:Dsg1a	APN	18	20340996	missense	probably benign	0.06
IGL01566:Dsg1a	APN	18	20336783	splice site	probably benign
IGL01582:Dsg1a	APN	18	20328848	missense	probably null	1.00
IGL01913:Dsg1a	APN	18	20322236	missense	probably damaging	1.00
IGL01926:Dsg1a	APN	18	20333584	missense	possibly damaging	0.60
IGL02102:Dsg1a	APN	18	20332032	missense	probably benign	0.01
IGL02900:Dsg1a	APN	18	20328656	splice site	probably benign
IGL02937:Dsg1a	APN	18	20331534	missense	possibly damaging	0.93
IGL02962:Dsg1a	APN	18	20340324	missense	possibly damaging	0.92
IGL03003:Dsg1a	APN	18	20336819	missense	probably benign	0.43
PIT4687001:Dsg1a	UTSW	18	20331698	missense	probably benign	0.16
R0126:Dsg1a	UTSW	18	20340878	missense	probably benign	0.00
R0284:Dsg1a	UTSW	18	20331627	missense	probably damaging	0.98
R0394:Dsg1a	UTSW	18	20333750	missense	probably damaging	1.00
R0543:Dsg1a	UTSW	18	20340863	missense	probably damaging	1.00
R0656:Dsg1a	UTSW	18	20335892	splice site	probably benign
R0733:Dsg1a	UTSW	18	20338668	missense	probably damaging	0.97
R0750:Dsg1a	UTSW	18	20340153	missense	probably benign	0.10
R1300:Dsg1a	UTSW	18	20332149	missense	probably benign	0.19
R1501:Dsg1a	UTSW	18	20332019	missense	probably damaging	1.00
R1523:Dsg1a	UTSW	18	20322317	missense	probably damaging	0.99
R1673:Dsg1a	UTSW	18	20331504	missense	probably damaging	1.00
R1980:Dsg1a	UTSW	18	20338650	missense	probably damaging	1.00
R2102:Dsg1a	UTSW	18	20333773	missense	probably damaging	1.00
R2132:Dsg1a	UTSW	18	20340797	missense	probably damaging	1.00
R2299:Dsg1a	UTSW	18	20340150	missense	probably damaging	1.00
R2426:Dsg1a	UTSW	18	20336804	missense	probably damaging	0.96
R3031:Dsg1a	UTSW	18	20340492	missense	probably damaging	1.00
R4044:Dsg1a	UTSW	18	20324030	missense	probably damaging	1.00
R4075:Dsg1a	UTSW	18	20340070	missense	possibly damaging	0.53
R4644:Dsg1a	UTSW	18	20340728	missense	probably benign	0.04
R4661:Dsg1a	UTSW	18	20340533	missense	probably damaging	0.99
R4816:Dsg1a	UTSW	18	20333722	missense	probably benign	0.10
R5221:Dsg1a	UTSW	18	20324014	missense	possibly damaging	0.64
R5257:Dsg1a	UTSW	18	20320931	missense	probably damaging	1.00
R5360:Dsg1a	UTSW	18	20340954	missense	probably damaging	0.96
R5547:Dsg1a	UTSW	18	20336040	critical splice donor site	probably null
R5702:Dsg1a	UTSW	18	20336865	critical splice donor site	probably null
R5987:Dsg1a	UTSW	18	20331542	missense	probably damaging	1.00
R6108:Dsg1a	UTSW	18	20340247	missense	probably benign	0.19
R6170:Dsg1a	UTSW	18	20335986	missense	probably damaging	0.99
R7018:Dsg1a	UTSW	18	20328738	missense	possibly damaging	0.48
R7201:Dsg1a	UTSW	18	20328311	missense	probably damaging	0.98
R7730:Dsg1a	UTSW	18	20331711	missense	possibly damaging	0.77
R7814:Dsg1a	UTSW	18	20338515	splice site	probably null
R8185:Dsg1a	UTSW	18	20340612	missense	probably damaging	1.00
R8297:Dsg1a	UTSW	18	20332033	missense	probably benign	0.02
R8377:Dsg1a	UTSW	18	20333774	missense	probably damaging	1.00
R8409:Dsg1a	UTSW	18	20340151	missense	probably damaging	1.00
R8775:Dsg1a	UTSW	18	20340507	missense	probably damaging	0.98
R8775-TAIL:Dsg1a	UTSW	18	20340507	missense	probably damaging	0.98
R8818:Dsg1a	UTSW	18	20340542	missense	possibly damaging	0.87
R8821:Dsg1a	UTSW	18	20320308	missense	probably damaging	0.96
R8831:Dsg1a	UTSW	18	20320308	missense	probably damaging	0.96
R9030:Dsg1a	UTSW	18	20340492	missense	probably damaging	1.00
R9205:Dsg1a	UTSW	18	20340171	missense	probably damaging	1.00
R9239:Dsg1a	UTSW	18	20340693	missense	probably damaging	1.00
R9410:Dsg1a	UTSW	18	20331533	missense	possibly damaging	0.50

Predicted Primers

PCR Primer
(F):5'- GATAGGCAATCTGAGCATGACCCC -3'
(R):5'- AGCCAGTGCTTTTATGTAGCCACG -3'

Sequencing Primer
(F):5'- GCATGACCCCTGAATTATCAAGTG -3'
(R):5'- TTTACCAATGCTAGGGAGCACTC -3'

Posted On

2013-04-16