Incidental Mutation 'R2181:Nelfa'
ID237182
Institutional Source Beutler Lab
Gene Symbol Nelfa
Ensembl Gene ENSMUSG00000029111
Gene Namenegative elongation factor complex member A, Whsc2
SynonymsWhsc2, Nelf-A, Whsc2h
MMRRC Submission 040183-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2181 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location33897916-33936413 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33900509 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 314 (N314D)
Ref Sequence ENSEMBL: ENSMUSP00000030993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030993] [ENSMUST00000058096] [ENSMUST00000066854] [ENSMUST00000075812] [ENSMUST00000137191] [ENSMUST00000139845]
Predicted Effect probably benign
Transcript: ENSMUST00000030993
AA Change: N314D

PolyPhen 2 Score 0.429 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000030993
Gene: ENSMUSG00000029111
AA Change: N314D

DomainStartEndE-ValueType
low complexity region 54 63 N/A INTRINSIC
low complexity region 280 294 N/A INTRINSIC
low complexity region 315 333 N/A INTRINSIC
low complexity region 339 365 N/A INTRINSIC
low complexity region 383 429 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058096
SMART Domains Protein: ENSMUSP00000058940
Gene: ENSMUSG00000057406

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
PWWP 220 285 3.84e-15 SMART
low complexity region 397 408 N/A INTRINSIC
HMG 452 522 7.64e-9 SMART
low complexity region 532 545 N/A INTRINSIC
low complexity region 629 643 N/A INTRINSIC
PHD 669 711 1.36e-6 SMART
RING 670 710 1.5e1 SMART
PHD 716 763 6.81e-1 SMART
RING 717 762 5.25e-2 SMART
PHD 833 873 2.35e-10 SMART
PWWP 878 940 2.67e-23 SMART
AWS 1011 1062 3.74e-27 SMART
SET 1063 1186 4.48e-43 SMART
PostSET 1187 1203 7.56e-4 SMART
low complexity region 1215 1236 N/A INTRINSIC
PHD 1241 1284 1.98e-8 SMART
low complexity region 1347 1360 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000066854
SMART Domains Protein: ENSMUSP00000067205
Gene: ENSMUSG00000057406

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
PWWP 220 285 3.84e-15 SMART
low complexity region 397 408 N/A INTRINSIC
HMG 452 522 7.64e-9 SMART
low complexity region 532 545 N/A INTRINSIC
low complexity region 630 644 N/A INTRINSIC
PHD 670 712 1.36e-6 SMART
RING 671 711 1.5e1 SMART
PHD 717 764 6.81e-1 SMART
RING 718 763 5.25e-2 SMART
PHD 834 874 2.35e-10 SMART
PWWP 879 941 2.67e-23 SMART
AWS 1012 1063 3.74e-27 SMART
SET 1064 1187 4.48e-43 SMART
PostSET 1188 1204 7.56e-4 SMART
low complexity region 1216 1237 N/A INTRINSIC
PHD 1242 1285 1.98e-8 SMART
low complexity region 1348 1361 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075812
SMART Domains Protein: ENSMUSP00000075210
Gene: ENSMUSG00000057406

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
PWWP 220 285 3.84e-15 SMART
low complexity region 397 408 N/A INTRINSIC
HMG 452 522 7.64e-9 SMART
low complexity region 532 545 N/A INTRINSIC
low complexity region 630 644 N/A INTRINSIC
PHD 670 712 1.36e-6 SMART
RING 671 711 1.5e1 SMART
PHD 717 764 6.81e-1 SMART
RING 718 763 5.25e-2 SMART
PHD 834 874 2.35e-10 SMART
PWWP 879 941 2.67e-23 SMART
AWS 1012 1063 3.74e-27 SMART
SET 1064 1187 4.48e-43 SMART
PostSET 1188 1204 7.56e-4 SMART
low complexity region 1216 1237 N/A INTRINSIC
PHD 1242 1285 1.98e-8 SMART
low complexity region 1348 1361 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137191
SMART Domains Protein: ENSMUSP00000122310
Gene: ENSMUSG00000057406

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
Pfam:PWWP 220 332 4.9e-26 PFAM
low complexity region 397 408 N/A INTRINSIC
HMG 452 522 7.64e-9 SMART
low complexity region 532 545 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139845
SMART Domains Protein: ENSMUSP00000123460
Gene: ENSMUSG00000057406

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
Pfam:PWWP 220 332 4.9e-26 PFAM
low complexity region 397 408 N/A INTRINSIC
HMG 452 522 7.64e-9 SMART
low complexity region 532 545 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183676
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is expressed ubiquitously with higher levels in fetal than in adult tissues. It encodes a protein sharing 93% sequence identity with the mouse protein. Wolf-Hirschhorn syndrome (WHS) is a malformation syndrome associated with a hemizygous deletion of the distal short arm of chromosome 4. This gene is mapped to the 165 kb WHS critical region, and may play a role in the phenotype of the WHS or Pitt-Rogers-Danks syndrome. The encoded protein is found to be capable of reacting with HLA-A2-restricted and tumor-specific cytotoxic T lymphocytes, suggesting a target for use in specific immunotherapy for a large number of cancer patients. This protein has also been shown to be a member of the NELF (negative elongation factor) protein complex that participates in the regulation of RNA polymerase II transcription elongation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700037C18Rik C T 16: 3,907,086 S43N possibly damaging Het
Abcb5 T G 12: 118,867,946 I1224L possibly damaging Het
Adgra2 G A 8: 27,121,673 G1002S probably damaging Het
Arhgap28 T C 17: 67,896,117 T114A probably damaging Het
Colec12 T A 18: 9,846,828 S75T probably damaging Het
Cyp2c67 A G 19: 39,609,097 C486R possibly damaging Het
Ecm2 T A 13: 49,530,289 L581Q probably damaging Het
Faxc T A 4: 21,931,591 S10T probably benign Het
Frem2 A G 3: 53,574,587 I1893T possibly damaging Het
Gabrr3 T A 16: 59,448,009 D328E probably damaging Het
Gbp7 A G 3: 142,544,030 I421V possibly damaging Het
Gorasp1 A G 9: 119,928,356 S317P probably damaging Het
Htr6 A G 4: 139,074,425 S113P probably damaging Het
Ift74 A G 4: 94,632,714 E168G probably damaging Het
Kdm6b A T 11: 69,401,126 Y1443* probably null Het
Mmp28 A C 11: 83,442,717 V466G possibly damaging Het
Nbea A T 3: 56,029,939 S750R possibly damaging Het
Nbeal1 T C 1: 60,278,780 F1959L probably damaging Het
Numbl T A 7: 27,268,921 probably null Het
Olfr1370 G T 13: 21,073,224 P26T probably damaging Het
Olfr1467 G T 19: 13,365,074 V149F probably benign Het
Olfr272 T A 4: 52,911,524 K90M probably damaging Het
Olfr346 G A 2: 36,688,334 D111N probably damaging Het
Olfr678 T C 7: 105,070,211 V248A possibly damaging Het
Penk T C 4: 4,134,041 probably null Het
Pglyrp2 A G 17: 32,418,962 S31P probably damaging Het
Pigg T C 5: 108,336,500 S538P probably damaging Het
Pld2 A G 11: 70,542,989 T252A possibly damaging Het
Ppp2r5e T C 12: 75,462,324 I394V probably benign Het
Sh3rf1 G T 8: 61,363,238 V510F probably damaging Het
Slc4a2 A G 5: 24,435,653 H677R possibly damaging Het
Stam2 A T 2: 52,703,144 H345Q probably benign Het
Tmtc3 T C 10: 100,448,973 N600S probably benign Het
Trappc8 A G 18: 20,819,222 probably null Het
Vmn1r72 A T 7: 11,669,668 C284* probably null Het
Vmn2r76 T C 7: 86,225,535 I745V probably benign Het
Zfhx4 A C 3: 5,403,332 D2850A probably damaging Het
Zfp764 A G 7: 127,406,499 W36R probably damaging Het
Zfp804b G A 5: 6,771,674 T463I probably damaging Het
Zfp811 T G 17: 32,797,721 K448N probably damaging Het
Other mutations in Nelfa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Nelfa APN 5 33898802 missense probably damaging 0.98
R0590:Nelfa UTSW 5 33901825 missense probably damaging 1.00
R0613:Nelfa UTSW 5 33903463 splice site probably benign
R1533:Nelfa UTSW 5 33898871 missense probably damaging 0.98
R4246:Nelfa UTSW 5 33899029 missense probably damaging 1.00
R4398:Nelfa UTSW 5 33901279 missense possibly damaging 0.66
R4657:Nelfa UTSW 5 33901813 missense probably benign 0.08
R4973:Nelfa UTSW 5 33901818 missense probably benign 0.04
R5424:Nelfa UTSW 5 33921845 critical splice donor site probably null
R5614:Nelfa UTSW 5 33920500 missense probably damaging 1.00
R5737:Nelfa UTSW 5 33899113 critical splice acceptor site probably null
R6135:Nelfa UTSW 5 33899276 splice site probably null
R6153:Nelfa UTSW 5 33898879 missense probably damaging 1.00
R7231:Nelfa UTSW 5 33898825 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAGTACCTGTGAGCTTCC -3'
(R):5'- GGTTAGAGAAGCCACTATCCCG -3'

Sequencing Primer
(F):5'- GAGCTTCCCAGGTTGGTATACC -3'
(R):5'- GGCCCTGGGGATAGAAGTACTTG -3'
Posted On2014-10-02