Incidental Mutation 'R2181:Olfr678'
ID237188
Institutional Source Beutler Lab
Gene Symbol Olfr678
Ensembl Gene ENSMUSG00000073913
Gene Nameolfactory receptor 678
SynonymsMOR32-5, GA_x6K02T2PBJ9-7698491-7699432
MMRRC Submission 040183-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R2181 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location105064475-105071639 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105070211 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 248 (V248A)
Ref Sequence ENSEMBL: ENSMUSP00000150213 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098160] [ENSMUST00000213622]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098160
AA Change: V248A

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000095763
Gene: ENSMUSG00000073913
AA Change: V248A

DomainStartEndE-ValueType
Pfam:7tm_4 33 311 2.2e-115 PFAM
Pfam:7TM_GPCR_Srsx 37 212 2.8e-6 PFAM
Pfam:7tm_1 43 293 8e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213622
AA Change: V248A

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700037C18Rik C T 16: 3,907,086 S43N possibly damaging Het
Abcb5 T G 12: 118,867,946 I1224L possibly damaging Het
Adgra2 G A 8: 27,121,673 G1002S probably damaging Het
Arhgap28 T C 17: 67,896,117 T114A probably damaging Het
Colec12 T A 18: 9,846,828 S75T probably damaging Het
Cyp2c67 A G 19: 39,609,097 C486R possibly damaging Het
Ecm2 T A 13: 49,530,289 L581Q probably damaging Het
Faxc T A 4: 21,931,591 S10T probably benign Het
Frem2 A G 3: 53,574,587 I1893T possibly damaging Het
Gabrr3 T A 16: 59,448,009 D328E probably damaging Het
Gbp7 A G 3: 142,544,030 I421V possibly damaging Het
Gorasp1 A G 9: 119,928,356 S317P probably damaging Het
Htr6 A G 4: 139,074,425 S113P probably damaging Het
Ift74 A G 4: 94,632,714 E168G probably damaging Het
Kdm6b A T 11: 69,401,126 Y1443* probably null Het
Mmp28 A C 11: 83,442,717 V466G possibly damaging Het
Nbea A T 3: 56,029,939 S750R possibly damaging Het
Nbeal1 T C 1: 60,278,780 F1959L probably damaging Het
Nelfa T C 5: 33,900,509 N314D probably benign Het
Numbl T A 7: 27,268,921 probably null Het
Olfr1370 G T 13: 21,073,224 P26T probably damaging Het
Olfr1467 G T 19: 13,365,074 V149F probably benign Het
Olfr272 T A 4: 52,911,524 K90M probably damaging Het
Olfr346 G A 2: 36,688,334 D111N probably damaging Het
Penk T C 4: 4,134,041 probably null Het
Pglyrp2 A G 17: 32,418,962 S31P probably damaging Het
Pigg T C 5: 108,336,500 S538P probably damaging Het
Pld2 A G 11: 70,542,989 T252A possibly damaging Het
Ppp2r5e T C 12: 75,462,324 I394V probably benign Het
Sh3rf1 G T 8: 61,363,238 V510F probably damaging Het
Slc4a2 A G 5: 24,435,653 H677R possibly damaging Het
Stam2 A T 2: 52,703,144 H345Q probably benign Het
Tmtc3 T C 10: 100,448,973 N600S probably benign Het
Trappc8 A G 18: 20,819,222 probably null Het
Vmn1r72 A T 7: 11,669,668 C284* probably null Het
Vmn2r76 T C 7: 86,225,535 I745V probably benign Het
Zfhx4 A C 3: 5,403,332 D2850A probably damaging Het
Zfp764 A G 7: 127,406,499 W36R probably damaging Het
Zfp804b G A 5: 6,771,674 T463I probably damaging Het
Zfp811 T G 17: 32,797,721 K448N probably damaging Het
Other mutations in Olfr678
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01125:Olfr678 APN 7 105069601 missense probably benign 0.44
IGL01469:Olfr678 APN 7 105070388 missense probably benign 0.05
IGL01726:Olfr678 APN 7 105069629 missense probably damaging 1.00
IGL03263:Olfr678 APN 7 105070002 missense probably damaging 1.00
R1423:Olfr678 UTSW 7 105070019 missense probably damaging 1.00
R4594:Olfr678 UTSW 7 105069590 missense probably benign 0.00
R5376:Olfr678 UTSW 7 105070357 missense probably damaging 1.00
R5782:Olfr678 UTSW 7 105069749 missense probably damaging 1.00
R5847:Olfr678 UTSW 7 105069857 missense probably benign 0.01
R6418:Olfr678 UTSW 7 105070307 missense probably damaging 1.00
R6664:Olfr678 UTSW 7 105070188 missense possibly damaging 0.64
R7593:Olfr678 UTSW 7 105069497 missense probably benign 0.27
R8813:Olfr678 UTSW 7 105070311 nonsense probably null
R8841:Olfr678 UTSW 7 105070272 missense possibly damaging 0.69
R8933:Olfr678 UTSW 7 105069392 start gained probably benign
RF015:Olfr678 UTSW 7 105070048 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGGTTTGGCAAAGCTAGC -3'
(R):5'- CTGAATTTCAGTGCATCTTAGGG -3'

Sequencing Primer
(F):5'- GCTAGCATGTGCCAATATCAAGGTC -3'
(R):5'- CAGTGCATCTTAGGGTTAAGCATTC -3'
Posted On2014-10-02