Incidental Mutation 'R2248:Khnyn'
ID240978
Institutional Source Beutler Lab
Gene Symbol Khnyn
Ensembl Gene ENSMUSG00000047153
Gene NameKH and NYN domain containing
Synonyms
MMRRC Submission 040248-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R2248 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location55884947-55898775 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 55886738 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 150 (S150T)
Ref Sequence ENSEMBL: ENSMUSP00000153796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022831] [ENSMUST00000063871] [ENSMUST00000172378] [ENSMUST00000228462]
Predicted Effect probably benign
Transcript: ENSMUST00000022831
AA Change: S150T

PolyPhen 2 Score 0.154 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000022831
Gene: ENSMUSG00000047153
AA Change: S150T

DomainStartEndE-ValueType
low complexity region 350 365 N/A INTRINSIC
low complexity region 367 380 N/A INTRINSIC
Pfam:RNase_Zc3h12a 429 582 1.9e-66 PFAM
low complexity region 623 637 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000063871
SMART Domains Protein: ENSMUSP00000070494
Gene: ENSMUSG00000040380

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
C1Q 57 197 6.3e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172378
SMART Domains Protein: ENSMUSP00000127798
Gene: ENSMUSG00000040380

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
C1Q 57 197 6.3e-40 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227462
Predicted Effect probably benign
Transcript: ENSMUST00000228462
AA Change: S150T

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: This gene encodes a protein with a C-terminal RNA modifying domain that belongs to a family of ribonucleases typified by eukaryotic Nedd4-binding protein1 and the bacterial YacP-like nucleases (NYN). The NYN domain shares a common protein fold with two other groups of nucleases, the PilT N-terminal nuclease and FLAP nuclease superfamilies. In addition to the NYN domain, the protein encoded by this gene also contains an N-terminal K homology RNA-binding domain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik A G 9: 22,444,114 T482A probably benign Het
Abca2 A G 2: 25,433,464 probably benign Het
Afp A G 5: 90,501,570 D332G probably damaging Het
AI593442 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA 9: 52,677,814 probably benign Het
Aldh1a2 A T 9: 71,215,862 I6F possibly damaging Het
Alg6 C T 4: 99,738,207 A84V probably damaging Het
Ank T A 15: 27,562,711 probably null Het
Ano5 A T 7: 51,593,789 M837L probably benign Het
Arl8b A G 6: 108,783,343 Y30C probably benign Het
Bfsp1 A T 2: 143,827,652 probably null Het
Cdhr1 C G 14: 37,081,377 V581L probably benign Het
Chst8 G T 7: 34,748,172 T7K probably damaging Het
Clca3b T C 3: 144,825,219 K790R probably benign Het
Clta A G 4: 44,012,852 N21D probably damaging Het
Col6a4 T G 9: 106,079,959 E222A probably benign Het
Dcc G T 18: 71,826,168 Q178K probably benign Het
Dpysl3 T C 18: 43,358,293 D140G possibly damaging Het
Dthd1 A T 5: 62,849,900 D648V probably damaging Het
Eva1c A G 16: 90,831,325 N18S probably benign Het
Flnc A G 6: 29,451,401 H1538R probably damaging Het
Foxn3 T C 12: 99,196,556 E362G probably benign Het
Frk C A 10: 34,608,531 T500K probably benign Het
Glipr1l1 A G 10: 112,062,287 E99G probably benign Het
Gm6169 C A 13: 97,098,898 V114F possibly damaging Het
Gphn T C 12: 78,454,821 L120P probably damaging Het
Gpr152 T C 19: 4,143,806 S449P probably benign Het
Greb1 T A 12: 16,680,378 I1655F possibly damaging Het
Hectd1 G T 12: 51,806,471 T89N probably damaging Het
Helz2 A C 2: 181,233,433 I1756S probably benign Het
Hydin G T 8: 110,578,203 R3825L probably benign Het
Ifi207 G A 1: 173,736,470 probably benign Het
Itpr3 A T 17: 27,115,059 E2035V probably damaging Het
Kif21b T C 1: 136,172,966 I1595T probably damaging Het
Lgsn A T 1: 31,203,526 T230S possibly damaging Het
Limch1 G T 5: 67,044,399 G838V probably damaging Het
Lrp2 T A 2: 69,511,010 D942V probably damaging Het
Lrrc31 T A 3: 30,689,901 T153S possibly damaging Het
Mal2 T A 15: 54,588,336 I51N probably damaging Het
Mroh2a T C 1: 88,256,754 V1453A probably benign Het
Mycbp2 T A 14: 103,169,859 Q385L possibly damaging Het
Nav3 T A 10: 109,696,227 D2117V probably damaging Het
Ntn1 T C 11: 68,277,572 N353S possibly damaging Het
Oas1c T C 5: 120,802,861 E289G possibly damaging Het
Olfr1141 T C 2: 87,753,943 I17V probably null Het
Olfr1254 C A 2: 89,789,180 M57I possibly damaging Het
Olfr165 A G 16: 19,407,194 V274A probably damaging Het
Plk1 A G 7: 122,168,821 probably benign Het
Pms2 G A 5: 143,916,506 V230M probably damaging Het
Pole3 C A 4: 62,525,013 probably benign Het
Ppp2r5c T C 12: 110,485,923 F22S probably benign Het
Ptcd3 A T 6: 71,894,285 probably null Het
Ptprq A T 10: 107,643,070 probably null Het
Rab18 T A 18: 6,788,629 C199S probably damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Sacs A G 14: 61,212,802 N4099S probably damaging Het
Sh3yl1 T A 12: 30,942,870 probably null Het
Slco1c1 T A 6: 141,546,689 I217N probably damaging Het
Syne2 C T 12: 76,096,904 T6241I probably damaging Het
Tas2r119 T C 15: 32,178,151 F288L possibly damaging Het
Tmod2 G T 9: 75,592,649 T107N probably benign Het
Trappc6b T C 12: 59,050,381 T52A probably damaging Het
Tsen54 A G 11: 115,815,406 E122G probably damaging Het
Tspear A G 10: 77,873,269 N443S probably damaging Het
Unc80 A G 1: 66,623,206 probably benign Het
Virma T A 4: 11,518,927 Y725N probably damaging Het
Vwa7 G A 17: 35,019,043 D207N probably benign Het
Other mutations in Khnyn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01746:Khnyn APN 14 55886982 missense probably benign 0.02
IGL01924:Khnyn APN 14 55894969 missense probably benign 0.03
IGL01990:Khnyn APN 14 55887588 missense possibly damaging 0.87
R0310:Khnyn UTSW 14 55887968 missense probably damaging 1.00
R1822:Khnyn UTSW 14 55885852 missense probably damaging 1.00
R4333:Khnyn UTSW 14 55894042 missense probably damaging 1.00
R4334:Khnyn UTSW 14 55894042 missense probably damaging 1.00
R4600:Khnyn UTSW 14 55886981 missense probably benign 0.02
R4731:Khnyn UTSW 14 55886489 splice site probably null
R4732:Khnyn UTSW 14 55886489 splice site probably null
R4733:Khnyn UTSW 14 55886489 splice site probably null
R5063:Khnyn UTSW 14 55887203 nonsense probably null
R5434:Khnyn UTSW 14 55887500 missense probably damaging 1.00
R5908:Khnyn UTSW 14 55887066 missense probably benign
R5928:Khnyn UTSW 14 55885887 missense probably damaging 1.00
R6144:Khnyn UTSW 14 55887839 missense probably damaging 0.98
R6147:Khnyn UTSW 14 55887603 missense probably damaging 1.00
R6353:Khnyn UTSW 14 55894303 missense possibly damaging 0.89
R7179:Khnyn UTSW 14 55894354 missense probably damaging 1.00
R7658:Khnyn UTSW 14 55887139 nonsense probably null
R7755:Khnyn UTSW 14 55887968 missense probably damaging 1.00
R7831:Khnyn UTSW 14 55887846 critical splice donor site probably null
R7914:Khnyn UTSW 14 55887846 critical splice donor site probably null
R8006:Khnyn UTSW 14 55887590 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TGCACTGCATCTTTCTGGGAG -3'
(R):5'- GAATTCCCTGCCTTCATTCAAG -3'

Sequencing Primer
(F):5'- ATCTTTCTGGGAGCCCACG -3'
(R):5'- TGACTCCCTGGAACTGAGGACTC -3'
Posted On2014-10-15