Incidental Mutation 'R2285:Nxpe3'
ID243290
Institutional Source Beutler Lab
Gene Symbol Nxpe3
Ensembl Gene ENSMUSG00000075033
Gene Nameneurexophilin and PC-esterase domain family, member 3
SynonymsFam55c, LOC208684, LOC385658
MMRRC Submission 040284-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R2285 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location55839953-55895285 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 55866225 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 140 (G140D)
Ref Sequence ENSEMBL: ENSMUSP00000097296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099705]
Predicted Effect probably damaging
Transcript: ENSMUST00000099705
AA Change: G140D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097296
Gene: ENSMUSG00000075033
AA Change: G140D

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Neurexophilin 73 284 2.9e-64 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexophilin family of neuropeptide-like glycoproteins. The encoded protein contains a variable N-terminal domain, a highly conserved neurexophilin and PC-esterase (NXPE) central domain, a short linker region, and a cysteine-rich C-terminal domain. This protein binds alpha neurexins, a group of presynaptic transmembrane receptors that promote adhesion between dendrites and axons. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 A G 5: 104,939,171 Y532H probably damaging Het
Bbs9 T G 9: 22,678,934 L656W probably damaging Het
Clu T C 14: 65,980,959 S423P probably benign Het
Cnpy4 A G 5: 138,192,825 probably null Het
Col28a1 A T 6: 8,097,078 V440E probably damaging Het
Colgalt2 A G 1: 152,468,550 N121S probably benign Het
Cpa5 G T 6: 30,615,064 V67L probably benign Het
Emilin1 G A 5: 30,918,200 R595H probably damaging Het
Fam92b T C 8: 120,168,537 N209D probably benign Het
Fat3 G T 9: 16,376,173 Q685K probably damaging Het
Gfra4 C T 2: 131,041,731 R34H probably damaging Het
Gp2 C T 7: 119,450,085 V410M possibly damaging Het
Ints9 T C 14: 65,007,997 F235L possibly damaging Het
Kcnh3 A T 15: 99,241,992 I920F probably benign Het
Mipep T C 14: 60,787,394 S95P possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Olfr792 A G 10: 129,540,668 I44V probably benign Het
Ppcs T A 4: 119,418,977 K137I possibly damaging Het
Tmc1 A G 19: 20,789,799 M731T probably damaging Het
Tubgcp6 A T 15: 89,122,474 V115D probably damaging Het
Usp54 G A 14: 20,561,178 T1190I possibly damaging Het
Zfp51 T A 17: 21,463,875 F251I probably damaging Het
Other mutations in Nxpe3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00840:Nxpe3 APN 16 55844232 missense probably damaging 0.98
IGL01743:Nxpe3 APN 16 55849765 missense probably benign 0.00
IGL02355:Nxpe3 APN 16 55890586 missense probably benign 0.11
IGL02362:Nxpe3 APN 16 55890586 missense probably benign 0.11
IGL02750:Nxpe3 APN 16 55860375 missense probably benign 0.21
IGL02792:Nxpe3 APN 16 55866172 missense probably damaging 0.98
IGL03383:Nxpe3 APN 16 55849713 missense probably benign 0.00
R0126:Nxpe3 UTSW 16 55866229 missense possibly damaging 0.94
R0348:Nxpe3 UTSW 16 55866535 missense probably benign 0.01
R0526:Nxpe3 UTSW 16 55866517 missense possibly damaging 0.86
R1752:Nxpe3 UTSW 16 55866474 missense probably benign
R1830:Nxpe3 UTSW 16 55866081 missense probably damaging 1.00
R3196:Nxpe3 UTSW 16 55849715 missense probably damaging 0.99
R4863:Nxpe3 UTSW 16 55849633 missense probably damaging 1.00
R4922:Nxpe3 UTSW 16 55860324 missense probably benign
R5308:Nxpe3 UTSW 16 55866471 missense probably benign 0.43
R5338:Nxpe3 UTSW 16 55866343 missense possibly damaging 0.52
R5539:Nxpe3 UTSW 16 55890671 missense possibly damaging 0.92
R5780:Nxpe3 UTSW 16 55866441 missense probably damaging 1.00
R5877:Nxpe3 UTSW 16 55866201 missense probably damaging 1.00
R6769:Nxpe3 UTSW 16 55866108 missense probably damaging 1.00
R6771:Nxpe3 UTSW 16 55866108 missense probably damaging 1.00
R6841:Nxpe3 UTSW 16 55844322 missense possibly damaging 0.65
R7660:Nxpe3 UTSW 16 55844327 missense probably damaging 0.96
Z1177:Nxpe3 UTSW 16 55866222 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGAAGAGACTCTTGAAATAGACC -3'
(R):5'- TTGCTGCCTCCAAGTGGAAG -3'

Sequencing Primer
(F):5'- GACTCTTGAAATAGACCCTGTCTGG -3'
(R):5'- TCCAAGTGGAAGGTGCCTGAC -3'
Posted On2014-10-16