Incidental Mutation 'R2285:Gp2'
ID243278
Institutional Source Beutler Lab
Gene Symbol Gp2
Ensembl Gene ENSMUSG00000030954
Gene Nameglycoprotein 2 (zymogen granule membrane)
Synonyms2310037I18Rik
MMRRC Submission 040284-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2285 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location119442537-119459285 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 119450085 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 410 (V410M)
Ref Sequence ENSEMBL: ENSMUSP00000146487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033255] [ENSMUST00000207887]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033255
AA Change: V410M

PolyPhen 2 Score 0.688 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000033255
Gene: ENSMUSG00000030954
AA Change: V410M

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Blast:ZP 164 213 1e-11 BLAST
ZP 225 477 5.39e-79 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000207887
AA Change: V410M

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein that is secreted from intracellular zymogen granules and associates with the plasma membrane via glycosylphosphatidylinositol (GPI) linkage. The encoded protein binds pathogens such as enterobacteria, thereby playing an important role in the innate immune response. The C-terminus of this protein is related to the C-terminus of the protein encoded by the neighboring gene, uromodulin (UMOD). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Homozygous null mice display no obvious abnormalities in pancreas morphology and function, development, growth, weight, behavior, life span, or fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 A G 5: 104,939,171 Y532H probably damaging Het
Bbs9 T G 9: 22,678,934 L656W probably damaging Het
Clu T C 14: 65,980,959 S423P probably benign Het
Cnpy4 A G 5: 138,192,825 probably null Het
Col28a1 A T 6: 8,097,078 V440E probably damaging Het
Colgalt2 A G 1: 152,468,550 N121S probably benign Het
Cpa5 G T 6: 30,615,064 V67L probably benign Het
Emilin1 G A 5: 30,918,200 R595H probably damaging Het
Fam92b T C 8: 120,168,537 N209D probably benign Het
Fat3 G T 9: 16,376,173 Q685K probably damaging Het
Gfra4 C T 2: 131,041,731 R34H probably damaging Het
Ints9 T C 14: 65,007,997 F235L possibly damaging Het
Kcnh3 A T 15: 99,241,992 I920F probably benign Het
Mipep T C 14: 60,787,394 S95P possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nxpe3 C T 16: 55,866,225 G140D probably damaging Het
Olfr792 A G 10: 129,540,668 I44V probably benign Het
Ppcs T A 4: 119,418,977 K137I possibly damaging Het
Tmc1 A G 19: 20,789,799 M731T probably damaging Het
Tubgcp6 A T 15: 89,122,474 V115D probably damaging Het
Usp54 G A 14: 20,561,178 T1190I possibly damaging Het
Zfp51 T A 17: 21,463,875 F251I probably damaging Het
Other mutations in Gp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Gp2 APN 7 119454390 missense probably damaging 0.96
IGL00818:Gp2 APN 7 119450127 missense possibly damaging 0.82
IGL01830:Gp2 APN 7 119451542 missense probably damaging 1.00
IGL02088:Gp2 APN 7 119454469 missense probably damaging 1.00
IGL02284:Gp2 APN 7 119450183 missense probably damaging 1.00
IGL02812:Gp2 APN 7 119452229 missense probably benign 0.01
IGL03049:Gp2 APN 7 119450294 missense possibly damaging 0.82
IGL03368:Gp2 APN 7 119452874 missense probably damaging 1.00
IGL03369:Gp2 APN 7 119451560 missense probably damaging 0.98
PIT4687001:Gp2 UTSW 7 119451578 missense possibly damaging 0.48
R0179:Gp2 UTSW 7 119452317 missense possibly damaging 0.81
R0367:Gp2 UTSW 7 119454568 missense probably damaging 1.00
R0544:Gp2 UTSW 7 119454496 missense probably benign 0.00
R0973:Gp2 UTSW 7 119454543 missense probably damaging 1.00
R0973:Gp2 UTSW 7 119454543 missense probably damaging 1.00
R0974:Gp2 UTSW 7 119454543 missense probably damaging 1.00
R1413:Gp2 UTSW 7 119451630 missense probably benign 0.15
R1557:Gp2 UTSW 7 119450079 missense probably damaging 1.00
R1638:Gp2 UTSW 7 119451498 critical splice donor site probably null
R1709:Gp2 UTSW 7 119451585 missense probably null 1.00
R1932:Gp2 UTSW 7 119454232 missense possibly damaging 0.81
R2109:Gp2 UTSW 7 119452932 missense probably benign
R2159:Gp2 UTSW 7 119452284 missense probably benign 0.06
R4657:Gp2 UTSW 7 119457168 missense probably benign 0.38
R4829:Gp2 UTSW 7 119457184 missense possibly damaging 0.56
R4854:Gp2 UTSW 7 119452199 missense possibly damaging 0.72
R4927:Gp2 UTSW 7 119452895 missense probably benign 0.00
R5022:Gp2 UTSW 7 119449114 missense probably damaging 1.00
R5033:Gp2 UTSW 7 119454291 missense probably damaging 0.99
R5443:Gp2 UTSW 7 119454598 missense possibly damaging 0.60
R5444:Gp2 UTSW 7 119454598 missense possibly damaging 0.60
R5681:Gp2 UTSW 7 119452294 missense possibly damaging 0.92
R5732:Gp2 UTSW 7 119449108 missense probably damaging 1.00
R5964:Gp2 UTSW 7 119449129 missense probably benign 0.02
R6963:Gp2 UTSW 7 119452897 missense probably benign 0.03
R7014:Gp2 UTSW 7 119451645 missense probably damaging 1.00
R7087:Gp2 UTSW 7 119450232 missense probably damaging 0.99
R7223:Gp2 UTSW 7 119451498 critical splice donor site probably null
R7497:Gp2 UTSW 7 119454606 missense probably damaging 1.00
R8165:Gp2 UTSW 7 119450152 missense probably damaging 1.00
R8343:Gp2 UTSW 7 119442787 missense probably benign 0.01
R8344:Gp2 UTSW 7 119442787 missense probably benign 0.01
R8345:Gp2 UTSW 7 119442787 missense probably benign 0.01
X0026:Gp2 UTSW 7 119442819 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTACCCAACGTGTCCAATTTG -3'
(R):5'- TGTCAAGATGGCCCTCTTCC -3'

Sequencing Primer
(F):5'- CCAACGTGTCCAATTTGTTTTAATAC -3'
(R):5'- GATGGCCCTCTTCCAAGAC -3'
Posted On2014-10-16