Incidental Mutation 'R2296:Cop1'
ID245167
Institutional Source Beutler Lab
Gene Symbol Cop1
Ensembl Gene ENSMUSG00000040782
Gene NameCOP1, E3 ubiquitin ligase
SynonymsCop1
MMRRC Submission 040295-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.495) question?
Stock #R2296 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location159232320-159347640 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 159244650 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 109 (V109M)
Ref Sequence ENSEMBL: ENSMUSP00000141285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076894] [ENSMUST00000192215] [ENSMUST00000195800]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076894
AA Change: V179M

PolyPhen 2 Score 0.794 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000076160
Gene: ENSMUSG00000040782
AA Change: V179M

DomainStartEndE-ValueType
low complexity region 2 87 N/A INTRINSIC
low complexity region 98 112 N/A INTRINSIC
RING 138 175 3.69e-8 SMART
coiled coil region 235 305 N/A INTRINSIC
WD40 412 451 1.72e0 SMART
WD40 462 501 3.4e-2 SMART
WD40 504 544 3.42e-7 SMART
WD40 547 586 6.79e-2 SMART
WD40 590 628 1.9e-5 SMART
WD40 631 670 4.46e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000192215
AA Change: V109M

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000141285
Gene: ENSMUSG00000040782
AA Change: V109M

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
low complexity region 28 42 N/A INTRINSIC
RING 68 105 1.8e-10 SMART
coiled coil region 161 231 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192762
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194049
Predicted Effect probably benign
Transcript: ENSMUST00000195554
Predicted Effect probably benign
Transcript: ENSMUST00000195800
SMART Domains Protein: ENSMUSP00000141941
Gene: ENSMUSG00000040782

DomainStartEndE-ValueType
low complexity region 2 87 N/A INTRINSIC
low complexity region 98 112 N/A INTRINSIC
Pfam:zf-C3HC4 138 159 3.2e-5 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a conditional allele activated in prostate epithelial cells exhibit prostate gland hyperplasia and prostate intraepithelial neoplasia due to increased cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik A G 1: 11,512,051 E68G possibly damaging Het
Apob A G 12: 7,994,879 D820G probably damaging Het
Bglap3 G C 3: 88,369,512 probably benign Het
Calr3 C T 8: 72,424,625 probably benign Het
Carmil1 A G 13: 24,115,509 L344P probably damaging Het
Dennd4b T A 3: 90,275,514 N879K probably damaging Het
Fam13b T C 18: 34,494,761 D129G possibly damaging Het
Fam222a C A 5: 114,610,966 H74Q possibly damaging Het
Gata5 A G 2: 180,328,320 M278T possibly damaging Het
Gm4951 T A 18: 60,245,470 C26S probably benign Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Inpp5k T G 11: 75,639,487 L251R probably damaging Het
Lrrc36 T G 8: 105,461,019 D522E possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Nras T A 3: 103,059,034 probably null Het
Nudt12 A G 17: 59,010,049 V201A possibly damaging Het
Phf2 T C 13: 48,835,278 E39G unknown Het
Serpinb3a A T 1: 107,047,561 V172D probably damaging Het
Stab2 T A 10: 86,954,474 probably null Het
Trim3 A G 7: 105,613,274 I559T probably damaging Het
Trp53bp1 A T 2: 121,209,247 S1304T possibly damaging Het
Xrcc5 A T 1: 72,346,326 K525N probably benign Het
Zfp110 T A 7: 12,849,540 V705D probably damaging Het
Other mutations in Cop1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02572:Cop1 APN 1 159308878 unclassified probably benign
IGL02945:Cop1 APN 1 159306689 missense probably benign 0.20
IGL03059:Cop1 APN 1 159306709 missense probably damaging 1.00
R0032:Cop1 UTSW 1 159325036 critical splice donor site probably null
R0179:Cop1 UTSW 1 159250066 missense probably benign 0.20
R0846:Cop1 UTSW 1 159319816 missense probably benign 0.26
R0988:Cop1 UTSW 1 159232847 missense possibly damaging 0.76
R0988:Cop1 UTSW 1 159244672 missense probably damaging 1.00
R2297:Cop1 UTSW 1 159252554 missense possibly damaging 0.53
R2504:Cop1 UTSW 1 159232805 missense probably damaging 0.98
R2974:Cop1 UTSW 1 159324929 missense possibly damaging 0.95
R4889:Cop1 UTSW 1 159284589 missense probably damaging 1.00
R4965:Cop1 UTSW 1 159239597 missense probably damaging 0.99
R4981:Cop1 UTSW 1 159325068 unclassified probably benign
R5124:Cop1 UTSW 1 159278112 missense probably damaging 0.96
R5263:Cop1 UTSW 1 159324937 missense probably damaging 1.00
R5268:Cop1 UTSW 1 159327164 missense probably damaging 1.00
R5470:Cop1 UTSW 1 159266860 intron probably benign
R5595:Cop1 UTSW 1 159250073 missense probably benign 0.00
R5919:Cop1 UTSW 1 159319724 missense probably damaging 1.00
R6386:Cop1 UTSW 1 159289031 missense probably damaging 1.00
R6865:Cop1 UTSW 1 159308954 missense probably damaging 1.00
R6995:Cop1 UTSW 1 159306584 missense probably damaging 1.00
R7056:Cop1 UTSW 1 159250077 missense probably damaging 0.98
R7146:Cop1 UTSW 1 159244352 intron probably null
R7242:Cop1 UTSW 1 159284548 missense probably benign 0.00
R7309:Cop1 UTSW 1 159306625 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GACCATAGGCATTTGCTTTCC -3'
(R):5'- TATGCCATAGCCCAAGAAGATG -3'

Sequencing Primer
(F):5'- AAAACTTAGTCCCCATTCACATTTC -3'
(R):5'- ATGAAAGCGCCCTGGTG -3'
Posted On2014-10-30