Incidental Mutation 'R2296:Nudt12'
ID245187
Institutional Source Beutler Lab
Gene Symbol Nudt12
Ensembl Gene ENSMUSG00000024228
Gene Namenudix (nucleoside diphosphate linked moiety X)-type motif 12
Synonyms
MMRRC Submission 040295-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2296 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location58999618-59013372 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59010049 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 201 (V201A)
Ref Sequence ENSEMBL: ENSMUSP00000133678 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025065] [ENSMUST00000174122]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025065
AA Change: V201A

PolyPhen 2 Score 0.851 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000025065
Gene: ENSMUSG00000024228
AA Change: V201A

DomainStartEndE-ValueType
ANK 11 40 2.43e3 SMART
ANK 45 74 1.1e-6 SMART
ANK 78 108 2.55e2 SMART
Pfam:NUDIX-like 147 277 3.2e-10 PFAM
Pfam:zf-NADH-PPase 279 309 2.7e-10 PFAM
Pfam:NUDIX 322 447 8.1e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145848
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152750
Predicted Effect possibly damaging
Transcript: ENSMUST00000174122
AA Change: V201A

PolyPhen 2 Score 0.851 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000133678
Gene: ENSMUSG00000024228
AA Change: V201A

DomainStartEndE-ValueType
ANK 11 40 2.43e3 SMART
ANK 45 74 1.1e-6 SMART
ANK 78 108 2.55e2 SMART
Pfam:NUDIX-like 147 277 2.4e-9 PFAM
Pfam:zf-NADH-PPase 279 311 5.9e-11 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nucleotides are involved in numerous biochemical reactions and pathways within the cell as substrates, cofactors, and effectors. Nudix hydrolases, such as NUDT12, regulate the concentrations of individual nucleotides and of nucleotide ratios in response to changing circumstances (Abdelraheim et al., 2003 [PubMed 12790796]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik A G 1: 11,512,051 E68G possibly damaging Het
Apob A G 12: 7,994,879 D820G probably damaging Het
Bglap3 G C 3: 88,369,512 probably benign Het
Calr3 C T 8: 72,424,625 probably benign Het
Carmil1 A G 13: 24,115,509 L344P probably damaging Het
Cop1 G A 1: 159,244,650 V109M possibly damaging Het
Dennd4b T A 3: 90,275,514 N879K probably damaging Het
Fam13b T C 18: 34,494,761 D129G possibly damaging Het
Fam222a C A 5: 114,610,966 H74Q possibly damaging Het
Gata5 A G 2: 180,328,320 M278T possibly damaging Het
Gm4951 T A 18: 60,245,470 C26S probably benign Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Inpp5k T G 11: 75,639,487 L251R probably damaging Het
Lrrc36 T G 8: 105,461,019 D522E possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Nras T A 3: 103,059,034 probably null Het
Phf2 T C 13: 48,835,278 E39G unknown Het
Serpinb3a A T 1: 107,047,561 V172D probably damaging Het
Stab2 T A 10: 86,954,474 probably null Het
Trim3 A G 7: 105,613,274 I559T probably damaging Het
Trp53bp1 A T 2: 121,209,247 S1304T possibly damaging Het
Xrcc5 A T 1: 72,346,326 K525N probably benign Het
Zfp110 T A 7: 12,849,540 V705D probably damaging Het
Other mutations in Nudt12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02860:Nudt12 APN 17 59010435 missense probably benign 0.01
IGL02904:Nudt12 APN 17 59010352 missense probably benign 0.00
IGL03206:Nudt12 APN 17 59007672 missense probably benign 0.00
R0121:Nudt12 UTSW 17 59007639 missense possibly damaging 0.80
R0673:Nudt12 UTSW 17 59007622 critical splice donor site probably null
R0761:Nudt12 UTSW 17 59011069 missense probably benign 0.00
R1079:Nudt12 UTSW 17 59011037 splice site probably benign
R1277:Nudt12 UTSW 17 59010136 missense probably damaging 0.98
R1815:Nudt12 UTSW 17 59010136 missense probably damaging 0.98
R1816:Nudt12 UTSW 17 59010136 missense probably damaging 0.98
R1834:Nudt12 UTSW 17 59011076 missense probably damaging 1.00
R2415:Nudt12 UTSW 17 59006608 missense probably damaging 0.99
R5011:Nudt12 UTSW 17 58996504 unclassified probably benign
R5384:Nudt12 UTSW 17 59003439 missense probably damaging 1.00
R5385:Nudt12 UTSW 17 59003439 missense probably damaging 1.00
R5874:Nudt12 UTSW 17 59010284 nonsense probably null
R6108:Nudt12 UTSW 17 59007749 missense probably damaging 1.00
R6477:Nudt12 UTSW 17 59011145 missense probably benign 0.12
R7030:Nudt12 UTSW 17 59003353 missense probably benign 0.22
R7592:Nudt12 UTSW 17 59006594 missense probably benign 0.02
R8252:Nudt12 UTSW 17 59011094 missense probably damaging 0.99
Z1177:Nudt12 UTSW 17 59011071 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCAGAAGAGCTGGCATTG -3'
(R):5'- TAGCAGAACACTACTGGACCG -3'

Sequencing Primer
(F):5'- GGCGGGTGGAGAAAATAACAATTTTC -3'
(R):5'- AATTCTGACTGGCTGCAAGC -3'
Posted On2014-10-30