Incidental Mutation 'R2297:Dtl'
ID245194
Institutional Source Beutler Lab
Gene Symbol Dtl
Ensembl Gene ENSMUSG00000037474
Gene Namedenticleless E3 ubiquitin protein ligase
Synonyms5730564G15Rik, 2810047L02Rik
MMRRC Submission 040296-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2297 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location191537356-191575544 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 191541095 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 567 (V567A)
Ref Sequence ENSEMBL: ENSMUSP00000027933 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027933] [ENSMUST00000195650]
Predicted Effect probably benign
Transcript: ENSMUST00000027933
AA Change: V567A

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000027933
Gene: ENSMUSG00000037474
AA Change: V567A

DomainStartEndE-ValueType
Blast:WD40 30 80 1e-24 BLAST
WD40 87 126 2.61e-3 SMART
WD40 129 169 8.04e-4 SMART
WD40 205 244 8.29e-1 SMART
Blast:WD40 265 299 1e-11 BLAST
WD40 304 345 1.29e-2 SMART
WD40 349 389 1.07e-8 SMART
low complexity region 427 454 N/A INTRINSIC
low complexity region 476 495 N/A INTRINSIC
low complexity region 505 521 N/A INTRINSIC
low complexity region 630 645 N/A INTRINSIC
low complexity region 674 690 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192556
Predicted Effect probably benign
Transcript: ENSMUST00000195650
SMART Domains Protein: ENSMUSP00000141218
Gene: ENSMUSG00000037474

DomainStartEndE-ValueType
Blast:WD40 30 80 2e-26 BLAST
WD40 87 126 1.6e-5 SMART
Blast:WD40 129 154 7e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195765
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mutation of this gene results in very early embryonic lethality around or before E1.5. In vitro siRNA knockdown experiments show that the gene is essential cell survival and cell cycle progression to allow proper blastocyst formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921536K21Rik G A 11: 3,890,127 A90V probably damaging Het
Aco2 A T 15: 81,903,908 D114V probably damaging Het
Cop1 C T 1: 159,252,554 H185Y possibly damaging Het
Cyp2a12 A G 7: 27,034,632 D330G possibly damaging Het
Dcaf6 T C 1: 165,399,862 Y232C probably damaging Het
Ddx42 T G 11: 106,242,939 D580E probably damaging Het
Fem1c T C 18: 46,506,161 K258R possibly damaging Het
Galnt12 T A 4: 47,113,834 V84D probably damaging Het
Grm1 T G 10: 11,080,414 D42A probably benign Het
H3f3a C T 1: 180,803,138 R117H probably benign Het
Ncapd3 C T 9: 27,041,501 R109* probably null Het
Olfr368 A G 2: 37,332,143 N132S probably benign Het
Pimreg T C 11: 72,043,080 S11P probably damaging Het
Ppp1r16b G A 2: 158,761,366 E404K possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Slc6a11 A G 6: 114,131,425 N50S probably benign Het
Stab2 T A 10: 86,954,474 probably null Het
Tmem132d T C 5: 128,268,544 T305A possibly damaging Het
Tnfrsf13b A G 11: 61,147,445 T185A probably benign Het
Trdn C A 10: 33,335,012 P400Q probably damaging Het
Zfp119b T A 17: 55,939,355 Y277F possibly damaging Het
Other mutations in Dtl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00678:Dtl APN 1 191546626 splice site probably null
IGL01069:Dtl APN 1 191561539 critical splice acceptor site probably null
IGL01135:Dtl APN 1 191548330 missense probably damaging 1.00
IGL01307:Dtl APN 1 191570699 missense possibly damaging 0.78
IGL01461:Dtl APN 1 191546617 missense possibly damaging 0.88
IGL01809:Dtl APN 1 191548303 missense probably damaging 1.00
IGL01958:Dtl APN 1 191568377 missense probably damaging 1.00
IGL02217:Dtl APN 1 191568314 missense probably damaging 1.00
IGL02408:Dtl APN 1 191541240 missense probably benign 0.00
IGL02445:Dtl APN 1 191558060 critical splice donor site probably null
IGL02661:Dtl APN 1 191541371 missense probably benign 0.09
IGL02864:Dtl APN 1 191556826 missense probably benign 0.04
IGL02897:Dtl APN 1 191541544 splice site probably benign
IGL03069:Dtl APN 1 191556896 splice site probably benign
PIT4418001:Dtl UTSW 1 191541317 missense possibly damaging 0.46
R0370:Dtl UTSW 1 191575350 missense probably benign 0.05
R0513:Dtl UTSW 1 191569707 nonsense probably null
R1386:Dtl UTSW 1 191569717 missense probably damaging 1.00
R1424:Dtl UTSW 1 191561537 missense probably benign 0.13
R1575:Dtl UTSW 1 191561546 splice site probably null
R2128:Dtl UTSW 1 191558110 missense probably damaging 0.99
R2344:Dtl UTSW 1 191548378 missense probably benign 0.00
R3121:Dtl UTSW 1 191553063 nonsense probably null
R3808:Dtl UTSW 1 191548354 missense probably damaging 1.00
R4722:Dtl UTSW 1 191556841 missense possibly damaging 0.52
R4753:Dtl UTSW 1 191569703 missense probably damaging 1.00
R4904:Dtl UTSW 1 191568345 missense probably damaging 0.99
R4965:Dtl UTSW 1 191546565 missense possibly damaging 0.93
R5068:Dtl UTSW 1 191568373 missense probably damaging 1.00
R5119:Dtl UTSW 1 191541506 missense probably damaging 1.00
R5872:Dtl UTSW 1 191546568 missense probably benign 0.00
R5911:Dtl UTSW 1 191568407 missense probably damaging 1.00
R5992:Dtl UTSW 1 191568572 splice site probably null
R6425:Dtl UTSW 1 191546623 missense probably benign 0.02
R7403:Dtl UTSW 1 191563173 missense probably damaging 1.00
R8756:Dtl UTSW 1 191539259 missense probably benign
R8835:Dtl UTSW 1 191561497 missense probably damaging 1.00
R8850:Dtl UTSW 1 191553063 nonsense probably null
X0018:Dtl UTSW 1 191568410 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTTCAGAAGCATAAGGACTG -3'
(R):5'- GTCGCTTAGAAACTGGGTGAC -3'

Sequencing Primer
(F):5'- CTTCAGAAGCATAAGGACTGACAGG -3'
(R):5'- GTGACCCGAACACCTTCCTC -3'
Posted On2014-10-30