Incidental Mutation 'R5992:Dtl'
ID482115
Institutional Source Beutler Lab
Gene Symbol Dtl
Ensembl Gene ENSMUSG00000037474
Gene Namedenticleless E3 ubiquitin protein ligase
Synonyms5730564G15Rik, 2810047L02Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5992 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location191537356-191575544 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 191568572 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000027933 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027933] [ENSMUST00000193977] [ENSMUST00000195650]
Predicted Effect probably null
Transcript: ENSMUST00000027933
SMART Domains Protein: ENSMUSP00000027933
Gene: ENSMUSG00000037474

DomainStartEndE-ValueType
Blast:WD40 30 80 1e-24 BLAST
WD40 87 126 2.61e-3 SMART
WD40 129 169 8.04e-4 SMART
WD40 205 244 8.29e-1 SMART
Blast:WD40 265 299 1e-11 BLAST
WD40 304 345 1.29e-2 SMART
WD40 349 389 1.07e-8 SMART
low complexity region 427 454 N/A INTRINSIC
low complexity region 476 495 N/A INTRINSIC
low complexity region 505 521 N/A INTRINSIC
low complexity region 630 645 N/A INTRINSIC
low complexity region 674 690 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192014
Predicted Effect probably benign
Transcript: ENSMUST00000193977
SMART Domains Protein: ENSMUSP00000142111
Gene: ENSMUSG00000037474

DomainStartEndE-ValueType
Blast:WD40 30 80 1e-26 BLAST
SCOP:d1e1aa_ 65 108 6e-5 SMART
Blast:WD40 87 113 6e-13 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194064
Predicted Effect probably benign
Transcript: ENSMUST00000195650
SMART Domains Protein: ENSMUSP00000141218
Gene: ENSMUSG00000037474

DomainStartEndE-ValueType
Blast:WD40 30 80 2e-26 BLAST
WD40 87 126 1.6e-5 SMART
Blast:WD40 129 154 7e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195765
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mutation of this gene results in very early embryonic lethality around or before E1.5. In vitro siRNA knockdown experiments show that the gene is essential cell survival and cell cycle progression to allow proper blastocyst formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T A 17: 45,508,623 L188* probably null Het
Acod1 C T 14: 103,055,035 R332C probably damaging Het
Adamts3 T A 5: 89,691,335 K852M probably damaging Het
Adm A T 7: 110,627,696 probably benign Het
Aff4 A G 11: 53,373,010 S286G probably damaging Het
Ank2 A G 3: 126,959,651 probably null Het
Aqr A T 2: 114,143,049 Y427* probably null Het
Arid1b C A 17: 4,994,956 probably benign Het
Arpp21 T A 9: 112,143,485 R259* probably null Het
Cep290 C T 10: 100,543,321 A55V possibly damaging Het
Chsy3 GT G 18: 59,176,166 probably null Het
Clcn2 T C 16: 20,713,654 E68G possibly damaging Het
Corin T A 5: 72,316,389 H699L probably benign Het
Cyld T C 8: 88,733,053 Y446H probably damaging Het
Dcst1 T A 3: 89,352,576 E613V probably damaging Het
Dlk1 T C 12: 109,455,581 C74R probably damaging Het
Dnah12 A C 14: 26,697,341 K128T probably benign Het
Dspp T A 5: 104,178,451 S893R unknown Het
F2rl1 T A 13: 95,514,270 S35C probably benign Het
Fcgbp A T 7: 28,120,534 Y2562F probably benign Het
Fgf10 A T 13: 118,715,508 D42V probably benign Het
Gm10271 A T 10: 116,972,592 F6L probably damaging Het
Gm21190 T A 5: 15,524,851 E256D probably damaging Het
Gm5157 A G 7: 21,185,421 S66P probably damaging Het
Gm884 A T 11: 103,613,792 M2450K possibly damaging Het
Hal T G 10: 93,490,916 L138R probably damaging Het
Hsd17b3 T C 13: 64,059,470 probably null Het
Lrsam1 T C 2: 32,955,222 T94A probably benign Het
Macc1 T C 12: 119,447,585 V696A probably damaging Het
Magi2 G A 5: 19,227,291 M1I probably null Het
March7 C A 2: 60,245,220 N674K probably benign Het
Mfap1b A G 2: 121,470,295 V34A probably benign Het
Mob3b G A 4: 35,084,069 S40L probably benign Het
Ndufs2 A T 1: 171,236,418 V386E probably damaging Het
Nfic C T 10: 81,420,747 A19T probably damaging Het
Nfs1 G A 2: 156,134,453 R174W probably damaging Het
Nin G T 12: 70,045,524 S670R possibly damaging Het
Nrxn1 T C 17: 90,623,507 I754V probably benign Het
Nwd1 T C 8: 72,653,573 probably null Het
Olfr1231 T A 2: 89,303,359 T78S possibly damaging Het
Olfr1238 T A 2: 89,406,879 M67L probably benign Het
Olfr575 G T 7: 102,955,009 N197K probably benign Het
Pcdhgb8 A G 18: 37,763,449 E524G probably damaging Het
Phlpp1 A T 1: 106,318,993 R638* probably null Het
Pkmyt1 G C 17: 23,735,326 W360S probably benign Het
Plxnd1 C A 6: 115,967,787 probably null Het
Poldip3 A T 15: 83,129,229 N322K probably damaging Het
Prmt3 A T 7: 49,828,947 I419L probably benign Het
Prss36 A T 7: 127,944,830 V123E probably damaging Het
Prss58 A G 6: 40,897,769 I46T probably damaging Het
Rac1 T C 5: 143,506,998 probably benign Het
Rb1cc1 A G 1: 6,233,996 Y36C probably damaging Het
Rif1 C G 2: 52,095,844 L614V probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rp1 A T 1: 4,148,703 F951L unknown Het
Rps6ka5 G T 12: 100,575,250 P417T possibly damaging Het
Ryr1 A G 7: 29,067,637 W2967R probably damaging Het
Sacs T A 14: 61,205,543 S1679R probably damaging Het
Scn1a A C 2: 66,335,456 W153G probably damaging Het
Serpinb7 A G 1: 107,445,996 Y114C probably damaging Het
Son T C 16: 91,658,904 M1513T probably benign Het
Spag8 C T 4: 43,651,534 V447M probably benign Het
St3gal2 T A 8: 110,969,553 Y257N probably damaging Het
Tars A T 15: 11,397,196 D40E probably damaging Het
Tlr3 T C 8: 45,397,814 H158R probably benign Het
Tppp2 G T 14: 51,918,935 V50L probably benign Het
Trrap T C 5: 144,810,184 S1503P probably benign Het
Ttll4 T G 1: 74,685,391 S573R probably damaging Het
Vmn2r104 A T 17: 20,029,485 N841K probably damaging Het
Vmn2r3 A T 3: 64,259,647 C688S probably damaging Het
Vps16 T C 2: 130,424,449 probably null Het
Zfp608 G A 18: 54,899,248 T540I probably benign Het
Zfp775 G A 6: 48,619,816 R208Q probably damaging Het
Other mutations in Dtl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00678:Dtl APN 1 191546626 splice site probably null
IGL01069:Dtl APN 1 191561539 critical splice acceptor site probably null
IGL01135:Dtl APN 1 191548330 missense probably damaging 1.00
IGL01307:Dtl APN 1 191570699 missense possibly damaging 0.78
IGL01461:Dtl APN 1 191546617 missense possibly damaging 0.88
IGL01809:Dtl APN 1 191548303 missense probably damaging 1.00
IGL01958:Dtl APN 1 191568377 missense probably damaging 1.00
IGL02217:Dtl APN 1 191568314 missense probably damaging 1.00
IGL02408:Dtl APN 1 191541240 missense probably benign 0.00
IGL02445:Dtl APN 1 191558060 critical splice donor site probably null
IGL02661:Dtl APN 1 191541371 missense probably benign 0.09
IGL02864:Dtl APN 1 191556826 missense probably benign 0.04
IGL02897:Dtl APN 1 191541544 splice site probably benign
IGL03069:Dtl APN 1 191556896 splice site probably benign
PIT4418001:Dtl UTSW 1 191541317 missense possibly damaging 0.46
R0370:Dtl UTSW 1 191575350 missense probably benign 0.05
R0513:Dtl UTSW 1 191569707 nonsense probably null
R1386:Dtl UTSW 1 191569717 missense probably damaging 1.00
R1424:Dtl UTSW 1 191561537 missense probably benign 0.13
R1575:Dtl UTSW 1 191561546 splice site probably null
R2128:Dtl UTSW 1 191558110 missense probably damaging 0.99
R2297:Dtl UTSW 1 191541095 missense probably benign 0.41
R2344:Dtl UTSW 1 191548378 missense probably benign 0.00
R3121:Dtl UTSW 1 191553063 nonsense probably null
R3808:Dtl UTSW 1 191548354 missense probably damaging 1.00
R4722:Dtl UTSW 1 191556841 missense possibly damaging 0.52
R4753:Dtl UTSW 1 191569703 missense probably damaging 1.00
R4904:Dtl UTSW 1 191568345 missense probably damaging 0.99
R4965:Dtl UTSW 1 191546565 missense possibly damaging 0.93
R5068:Dtl UTSW 1 191568373 missense probably damaging 1.00
R5119:Dtl UTSW 1 191541506 missense probably damaging 1.00
R5872:Dtl UTSW 1 191546568 missense probably benign 0.00
R5911:Dtl UTSW 1 191568407 missense probably damaging 1.00
R6425:Dtl UTSW 1 191546623 missense probably benign 0.02
R7403:Dtl UTSW 1 191563173 missense probably damaging 1.00
X0018:Dtl UTSW 1 191568410 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTGCTGTAACCTTCCAAAAG -3'
(R):5'- GCCTGTTGATAGTAGAGTACTAGC -3'

Sequencing Primer
(F):5'- CCCTTTATCAGCAGCTAC -3'
(R):5'- TCGTTGCTGTGAACAGACAC -3'
Posted On2017-06-27