Incidental Mutation 'R2300:Aldh6a1'
ID245308
Institutional Source Beutler Lab
Gene Symbol Aldh6a1
Ensembl Gene ENSMUSG00000021238
Gene Namealdehyde dehydrogenase family 6, subfamily A1
SynonymsMmsdh, 1110038I05Rik
MMRRC Submission 040299-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.285) question?
Stock #R2300 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location84430717-84451004 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 84439529 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 205 (T205N)
Ref Sequence ENSEMBL: ENSMUSP00000082288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085192] [ENSMUST00000220491]
Predicted Effect probably damaging
Transcript: ENSMUST00000085192
AA Change: T205N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082288
Gene: ENSMUSG00000021238
AA Change: T205N

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
low complexity region 30 36 N/A INTRINSIC
Pfam:Aldedh 48 512 1.9e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220491
Predicted Effect probably benign
Transcript: ENSMUST00000221969
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222062
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222641
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222656
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the aldehyde dehydrogenase protein family. The encoded enzyme is a mitochondrial methylmalonate semialdehyde dehydrogenase that plays a role in the valine and pyrimidine catabolic pathways. This enzyme catalyzes the irreversible oxidative decarboxylation of malonate and methylmalonate semialdehydes to acetyl- and propionyl-CoA. Mutations in the human gene result in Methylmalonate Semialdehyde Dehydrogenase Deficiency, characterized by elevated beta-alanine, 3-hydroxypropionic acid, and both isomers of 3-amino and 3-hydroxyisobutyric acids in urine organic acids. Alternate splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl1 G T 8: 83,930,117 E355* probably null Het
Arhgap24 A G 5: 102,860,425 I71V probably damaging Het
Arid2 A T 15: 96,402,006 E1800V probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Cd53 T C 3: 106,763,256 T154A probably benign Het
Chd7 G A 4: 8,855,241 A2157T probably benign Het
Clca4b A T 3: 144,916,671 N544K probably benign Het
Cntrl A G 2: 35,127,513 E444G probably benign Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Gabrr1 A G 4: 33,152,449 K130E probably benign Het
H3f3a C T 1: 180,803,138 R117H probably benign Het
Jag1 T C 2: 137,096,315 Y255C probably damaging Het
Kif11 A G 19: 37,411,539 T825A probably benign Het
Lama4 T A 10: 39,087,320 M1296K probably benign Het
Lrp1 G T 10: 127,556,915 C2760* probably null Het
Mrc2 G A 11: 105,348,431 probably null Het
Nolc1 CAG CAGAAG 19: 46,081,359 probably benign Het
Nolc1 CAG CAGTAG 19: 46,081,368 probably benign Het
Nop16 A G 13: 54,585,866 probably null Het
Olfr134 T A 17: 38,175,550 Y155* probably null Het
Olfr992 T C 2: 85,400,132 I134V probably benign Het
Ostf1 T C 19: 18,581,280 D213G probably damaging Het
Slc28a2 C T 2: 122,441,778 Q34* probably null Het
St18 A G 1: 6,855,402 D928G probably damaging Het
Stag1 T C 9: 100,712,500 V31A possibly damaging Het
Tcl1b1 G A 12: 105,164,524 A89T probably benign Het
Tsen54 A T 11: 115,822,078 S464C probably damaging Het
Ttn A G 2: 76,907,448 F4249S probably benign Het
Xdh A G 17: 73,891,265 F1209S probably damaging Het
Ylpm1 G A 12: 85,060,319 probably null Het
Other mutations in Aldh6a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01700:Aldh6a1 APN 12 84439538 missense probably damaging 1.00
IGL02213:Aldh6a1 APN 12 84432552 intron probably benign
IGL02489:Aldh6a1 APN 12 84433972 missense possibly damaging 0.66
IGL02806:Aldh6a1 APN 12 84439640 missense probably damaging 1.00
IGL02930:Aldh6a1 APN 12 84433982 missense possibly damaging 0.78
IGL03183:Aldh6a1 APN 12 84436440 splice site probably null
PIT4378001:Aldh6a1 UTSW 12 84441872 missense probably benign 0.01
R0015:Aldh6a1 UTSW 12 84441780 missense probably damaging 1.00
R0506:Aldh6a1 UTSW 12 84433526 missense probably damaging 1.00
R1458:Aldh6a1 UTSW 12 84439663 missense probably null 0.01
R1468:Aldh6a1 UTSW 12 84441770 missense possibly damaging 0.82
R1468:Aldh6a1 UTSW 12 84441770 missense possibly damaging 0.82
R1579:Aldh6a1 UTSW 12 84441848 missense possibly damaging 0.83
R4351:Aldh6a1 UTSW 12 84443761 missense probably benign 0.00
R4447:Aldh6a1 UTSW 12 84439709 missense possibly damaging 0.73
R5205:Aldh6a1 UTSW 12 84439644 missense probably damaging 1.00
R5242:Aldh6a1 UTSW 12 84436383 missense probably damaging 1.00
R5443:Aldh6a1 UTSW 12 84437971 splice site probably null
R6849:Aldh6a1 UTSW 12 84443787 missense probably benign 0.00
R7001:Aldh6a1 UTSW 12 84441888 missense probably damaging 1.00
R7182:Aldh6a1 UTSW 12 84441831 missense probably benign 0.19
R7417:Aldh6a1 UTSW 12 84441782 missense probably benign 0.01
R7492:Aldh6a1 UTSW 12 84436866 missense probably damaging 1.00
R7749:Aldh6a1 UTSW 12 84442081 missense probably benign 0.00
R8511:Aldh6a1 UTSW 12 84433971 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AGACATGTGACCTTCAAACGTG -3'
(R):5'- CTGTAGTGTGACATCCCTCATG -3'

Sequencing Primer
(F):5'- CCAGAGGGTATGAATTCAGTTCCC -3'
(R):5'- CTCATGCTGGGAGAGACCATG -3'
Posted On2014-10-30