Incidental Mutation 'R4351:Aldh6a1'
ID328517
Institutional Source Beutler Lab
Gene Symbol Aldh6a1
Ensembl Gene ENSMUSG00000021238
Gene Namealdehyde dehydrogenase family 6, subfamily A1
SynonymsMmsdh, 1110038I05Rik
MMRRC Submission 041106-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.238) question?
Stock #R4351 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location84430717-84451004 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84443761 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 27 (Y27H)
Ref Sequence ENSEMBL: ENSMUSP00000152269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085192] [ENSMUST00000220491]
Predicted Effect probably benign
Transcript: ENSMUST00000085192
AA Change: Y27H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000082288
Gene: ENSMUSG00000021238
AA Change: Y27H

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
low complexity region 30 36 N/A INTRINSIC
Pfam:Aldedh 48 512 1.9e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220491
AA Change: Y27H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000221969
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222062
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222641
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222656
Meta Mutation Damage Score 0.0752 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: This gene encodes a member of the aldehyde dehydrogenase protein family. The encoded enzyme is a mitochondrial methylmalonate semialdehyde dehydrogenase that plays a role in the valine and pyrimidine catabolic pathways. This enzyme catalyzes the irreversible oxidative decarboxylation of malonate and methylmalonate semialdehydes to acetyl- and propionyl-CoA. Mutations in the human gene result in Methylmalonate Semialdehyde Dehydrogenase Deficiency, characterized by elevated beta-alanine, 3-hydroxypropionic acid, and both isomers of 3-amino and 3-hydroxyisobutyric acids in urine organic acids. Alternate splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A G 1: 37,624,912 F635S probably benign Het
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Aak1 A G 6: 86,935,537 probably null Het
Abtb2 T A 2: 103,683,393 D382E possibly damaging Het
Adamts1 T A 16: 85,802,346 D122V probably benign Het
Adcy6 A T 15: 98,604,160 V191E probably benign Het
Adh1 A G 3: 138,280,497 T82A probably benign Het
Ak6 C T 13: 100,655,603 Q185* probably null Het
Apob A G 12: 7,993,054 M812V probably benign Het
Arhgef10 C A 8: 14,991,145 S748* probably null Het
Brd3 A T 2: 27,457,016 Y369N probably damaging Het
Dhh A G 15: 98,898,218 probably benign Het
Disp1 A G 1: 183,099,978 V200A probably benign Het
Dvl3 T C 16: 20,525,644 Y257H possibly damaging Het
Dzip1 T C 14: 118,883,526 D673G probably benign Het
Evx1 A G 6: 52,313,861 D6G probably damaging Het
Fam71f1 C G 6: 29,320,801 I141M probably damaging Het
Gfy T C 7: 45,177,616 E352G probably benign Het
Hars2 A G 18: 36,786,178 E123G probably damaging Het
Hsd17b4 A T 18: 50,142,634 D115V probably damaging Het
Lyn G A 4: 3,789,796 R443H probably damaging Het
Mecom C A 3: 29,966,738 V452L possibly damaging Het
Nckap1l A G 15: 103,486,819 T909A probably damaging Het
Ncor1 A G 11: 62,410,818 probably null Het
Nrp2 A G 1: 62,738,417 D127G probably damaging Het
Olfr1396 A G 11: 49,113,703 S8P probably damaging Het
Olfr965 T A 9: 39,719,569 M114K probably damaging Het
Prpmp5 T G 6: 132,313,661 Y25S unknown Het
Ptch1 C T 13: 63,534,329 R537H probably damaging Het
Rabgap1 A G 2: 37,483,782 T269A probably benign Het
Rnf31 AAC A 14: 55,601,098 probably null Het
Sptbn5 T C 2: 120,083,199 noncoding transcript Het
Sst A G 16: 23,889,815 S89P probably damaging Het
Tm2d3 A G 7: 65,695,191 Y49C probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Wdr81 A G 11: 75,441,812 L1921P probably damaging Het
Other mutations in Aldh6a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01700:Aldh6a1 APN 12 84439538 missense probably damaging 1.00
IGL02213:Aldh6a1 APN 12 84432552 intron probably benign
IGL02489:Aldh6a1 APN 12 84433972 missense possibly damaging 0.66
IGL02806:Aldh6a1 APN 12 84439640 missense probably damaging 1.00
IGL02930:Aldh6a1 APN 12 84433982 missense possibly damaging 0.78
IGL03183:Aldh6a1 APN 12 84436440 splice site probably null
PIT4378001:Aldh6a1 UTSW 12 84441872 missense probably benign 0.01
R0015:Aldh6a1 UTSW 12 84441780 missense probably damaging 1.00
R0506:Aldh6a1 UTSW 12 84433526 missense probably damaging 1.00
R1458:Aldh6a1 UTSW 12 84439663 missense probably null 0.01
R1468:Aldh6a1 UTSW 12 84441770 missense possibly damaging 0.82
R1468:Aldh6a1 UTSW 12 84441770 missense possibly damaging 0.82
R1579:Aldh6a1 UTSW 12 84441848 missense possibly damaging 0.83
R2300:Aldh6a1 UTSW 12 84439529 missense probably damaging 1.00
R4447:Aldh6a1 UTSW 12 84439709 missense possibly damaging 0.73
R5205:Aldh6a1 UTSW 12 84439644 missense probably damaging 1.00
R5242:Aldh6a1 UTSW 12 84436383 missense probably damaging 1.00
R5443:Aldh6a1 UTSW 12 84437971 splice site probably null
R6849:Aldh6a1 UTSW 12 84443787 missense probably benign 0.00
R7001:Aldh6a1 UTSW 12 84441888 missense probably damaging 1.00
R7182:Aldh6a1 UTSW 12 84441831 missense probably benign 0.19
R7417:Aldh6a1 UTSW 12 84441782 missense probably benign 0.01
R7492:Aldh6a1 UTSW 12 84436866 missense probably damaging 1.00
R7749:Aldh6a1 UTSW 12 84442081 missense probably benign 0.00
R8511:Aldh6a1 UTSW 12 84433971 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AAGGGGCTGGAGAGATGTCT -3'
(R):5'- TGCCCTCTTTTGTTATATCTGAAGAC -3'

Sequencing Primer
(F):5'- TTCCAGAGGACCCAGGTTCAATTC -3'
(R):5'- TCTGAAGACAGCTACAATGTACTCG -3'
Posted On2015-07-07