Incidental Mutation 'R2313:Alox5'
ID 245373
Institutional Source Beutler Lab
Gene Symbol Alox5
Ensembl Gene ENSMUSG00000025701
Gene Name arachidonate 5-lipoxygenase
Synonyms 5LO, 5-LOX, 5LX
Accession Numbers
Essential gene? Probably non essential (E-score: 0.095) question?
Stock # R2313 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 116387038-116438139 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 116390822 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 443 (D443V)
Ref Sequence ENSEMBL: ENSMUSP00000130780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026795] [ENSMUST00000079012] [ENSMUST00000101032] [ENSMUST00000164547] [ENSMUST00000203193] [ENSMUST00000203722] [ENSMUST00000170186]
AlphaFold P48999
Predicted Effect probably benign
Transcript: ENSMUST00000026795
AA Change: D443V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026795
Gene: ENSMUSG00000025701
AA Change: D443V

DomainStartEndE-ValueType
LH2 2 115 3.41e-39 SMART
Pfam:Lipoxygenase 212 662 1.5e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079012
SMART Domains Protein: ENSMUSP00000078024
Gene: ENSMUSG00000025702

DomainStartEndE-ValueType
low complexity region 47 64 N/A INTRINSIC
RINGv 75 123 1.16e-23 SMART
transmembrane domain 151 173 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101032
SMART Domains Protein: ENSMUSP00000098594
Gene: ENSMUSG00000025702

DomainStartEndE-ValueType
low complexity region 47 64 N/A INTRINSIC
RINGv 75 123 1.16e-23 SMART
transmembrane domain 151 173 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164547
AA Change: D443V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000130780
Gene: ENSMUSG00000025701
AA Change: D443V

DomainStartEndE-ValueType
LH2 2 115 3.41e-39 SMART
Pfam:Lipoxygenase 125 217 5.1e-12 PFAM
Pfam:Lipoxygenase 213 564 8.4e-133 PFAM
Pfam:Lipoxygenase 558 609 7.3e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167174
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167447
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167585
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169625
Predicted Effect probably benign
Transcript: ENSMUST00000203193
SMART Domains Protein: ENSMUSP00000145137
Gene: ENSMUSG00000025702

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
RINGv 36 84 2.9e-26 SMART
transmembrane domain 112 134 N/A INTRINSIC
transmembrane domain 149 171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203722
SMART Domains Protein: ENSMUSP00000145367
Gene: ENSMUSG00000025701

DomainStartEndE-ValueType
LH2 2 115 2.2e-41 SMART
Pfam:Lipoxygenase 213 430 3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170186
SMART Domains Protein: ENSMUSP00000130424
Gene: ENSMUSG00000025701

DomainStartEndE-ValueType
LH2 2 115 3.41e-39 SMART
Pfam:Lipoxygenase 150 220 1.9e-13 PFAM
Pfam:Lipoxygenase 215 432 8.6e-79 PFAM
Pfam:Lipoxygenase 426 634 1e-73 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the lipoxygenase gene family and plays a dual role in the synthesis of leukotrienes from arachidonic acid. The encoded protein, which is expressed specifically in bone marrow-derived cells, catalyzes the conversion of arachidonic acid to 5(S)-hydroperoxy-6-trans-8,11,14-cis-eicosatetraenoic acid, and further to the allylic epoxide 5(S)-trans-7,9-trans-11,14-cis-eicosatetrenoic acid (leukotriene A4). Leukotrienes are important mediators of a number of inflammatory and allergic conditions. Mutations in the promoter region of this gene lead to a diminished response to antileukotriene drugs used in the treatment of asthma and may also be associated with atherosclerosis and several cancers. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Nullizygous mice show altered inflammatory responses. One null mutation causes resistance to lethal anaphylaxis, abnormal eicosanoid production and neutrophil recruitment while another leads to increased body fat, bone density, leptin and VLDL cholesterol levels and resistance to autoimmune uveitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd53 A T 6: 83,740,662 (GRCm39) H95L probably damaging Het
Chrnb3 A G 8: 27,883,809 (GRCm39) Y182C probably damaging Het
Cln5 C T 14: 103,309,182 (GRCm39) R79* probably null Het
Cntn3 C A 6: 102,180,889 (GRCm39) V769L probably benign Het
Gpat4 G A 8: 23,670,171 (GRCm39) P286L probably damaging Het
Il1r1 T C 1: 40,352,470 (GRCm39) S550P probably benign Het
Klra7 T A 6: 130,205,505 (GRCm39) T132S probably benign Het
Lrch3 A G 16: 32,782,045 (GRCm39) N273S probably damaging Het
Lrriq3 A T 3: 154,869,660 (GRCm39) R328S probably benign Het
Mpp2 T C 11: 101,952,898 (GRCm39) E318G possibly damaging Het
Or4c122 C A 2: 89,079,285 (GRCm39) C239F probably damaging Het
Or4n4 G A 14: 50,519,431 (GRCm39) S93F probably damaging Het
Pglyrp2 A T 17: 32,637,673 (GRCm39) D118E probably damaging Het
Ppp4c A G 7: 126,386,629 (GRCm39) S153P probably damaging Het
Ptpn13 A G 5: 103,712,027 (GRCm39) S1642G probably damaging Het
Tmem59l A G 8: 70,939,951 (GRCm39) L6S unknown Het
Unc13d A G 11: 115,954,560 (GRCm39) F1016S probably damaging Het
Vwa8 C G 14: 79,149,658 (GRCm39) T140S probably damaging Het
Wdfy3 A G 5: 102,037,150 (GRCm39) F2046L probably damaging Het
Zfp788 A G 7: 41,298,312 (GRCm39) H316R probably damaging Het
Zfp994 T A 17: 22,420,266 (GRCm39) I228F probably damaging Het
Other mutations in Alox5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Alox5 APN 6 116,392,478 (GRCm39) missense probably damaging 1.00
IGL00954:Alox5 APN 6 116,431,260 (GRCm39) missense probably damaging 1.00
IGL01610:Alox5 APN 6 116,390,508 (GRCm39) missense probably damaging 1.00
IGL02161:Alox5 APN 6 116,400,154 (GRCm39) missense probably benign 0.31
IGL02653:Alox5 APN 6 116,392,438 (GRCm39) missense probably benign 0.41
IGL02903:Alox5 APN 6 116,397,296 (GRCm39) missense probably damaging 1.00
clanger UTSW 6 116,391,556 (GRCm39) missense probably damaging 1.00
nova UTSW 6 116,389,510 (GRCm39) nonsense probably null
timpani UTSW 6 116,392,417 (GRCm39) missense probably damaging 1.00
Triangle UTSW 6 116,404,098 (GRCm39) splice site probably null
R0265:Alox5 UTSW 6 116,397,323 (GRCm39) missense probably benign 0.04
R0347:Alox5 UTSW 6 116,390,513 (GRCm39) missense possibly damaging 0.88
R0543:Alox5 UTSW 6 116,431,278 (GRCm39) critical splice acceptor site probably null
R0633:Alox5 UTSW 6 116,397,345 (GRCm39) missense probably damaging 1.00
R0656:Alox5 UTSW 6 116,400,291 (GRCm39) splice site probably benign
R1298:Alox5 UTSW 6 116,404,225 (GRCm39) missense probably damaging 1.00
R1416:Alox5 UTSW 6 116,400,106 (GRCm39) nonsense probably null
R1484:Alox5 UTSW 6 116,431,128 (GRCm39) missense probably damaging 1.00
R1485:Alox5 UTSW 6 116,401,125 (GRCm39) missense probably damaging 1.00
R1518:Alox5 UTSW 6 116,390,741 (GRCm39) missense probably damaging 0.99
R1993:Alox5 UTSW 6 116,392,424 (GRCm39) missense probably damaging 1.00
R3125:Alox5 UTSW 6 116,404,098 (GRCm39) splice site probably null
R4042:Alox5 UTSW 6 116,437,979 (GRCm39) missense possibly damaging 0.95
R4092:Alox5 UTSW 6 116,389,635 (GRCm39) intron probably benign
R4356:Alox5 UTSW 6 116,397,219 (GRCm39) missense probably benign 0.05
R4367:Alox5 UTSW 6 116,437,924 (GRCm39) missense possibly damaging 0.86
R4690:Alox5 UTSW 6 116,400,150 (GRCm39) missense probably damaging 1.00
R4792:Alox5 UTSW 6 116,437,964 (GRCm39) missense possibly damaging 0.94
R4873:Alox5 UTSW 6 116,390,811 (GRCm39) splice site probably null
R4875:Alox5 UTSW 6 116,390,811 (GRCm39) splice site probably null
R5135:Alox5 UTSW 6 116,390,747 (GRCm39) missense probably benign 0.00
R5242:Alox5 UTSW 6 116,437,927 (GRCm39) missense probably damaging 0.97
R5343:Alox5 UTSW 6 116,390,468 (GRCm39) missense possibly damaging 0.95
R5780:Alox5 UTSW 6 116,397,310 (GRCm39) missense probably benign 0.10
R6348:Alox5 UTSW 6 116,391,556 (GRCm39) missense probably damaging 1.00
R6724:Alox5 UTSW 6 116,391,509 (GRCm39) missense probably damaging 1.00
R6769:Alox5 UTSW 6 116,392,145 (GRCm39) splice site probably null
R6954:Alox5 UTSW 6 116,397,241 (GRCm39) nonsense probably null
R7102:Alox5 UTSW 6 116,390,429 (GRCm39) missense probably benign 0.01
R7476:Alox5 UTSW 6 116,392,394 (GRCm39) missense probably benign 0.06
R7626:Alox5 UTSW 6 116,390,756 (GRCm39) missense possibly damaging 0.94
R7690:Alox5 UTSW 6 116,392,417 (GRCm39) missense probably damaging 1.00
R7912:Alox5 UTSW 6 116,389,497 (GRCm39) missense probably benign 0.05
R8234:Alox5 UTSW 6 116,390,835 (GRCm39) missense probably damaging 0.98
R8701:Alox5 UTSW 6 116,390,787 (GRCm39) missense possibly damaging 0.47
R8787:Alox5 UTSW 6 116,390,102 (GRCm39) missense probably damaging 0.99
R8910:Alox5 UTSW 6 116,389,510 (GRCm39) nonsense probably null
R9708:Alox5 UTSW 6 116,392,537 (GRCm39) missense probably damaging 1.00
X0028:Alox5 UTSW 6 116,401,115 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTCAATGTCGGACTCTGC -3'
(R):5'- AGACTGGCCTCTCTATACCC -3'

Sequencing Primer
(F):5'- AACCCAGGAGCAAGCTTG -3'
(R):5'- GGCCTCTCTATACCCAGCCAC -3'
Posted On 2014-10-30