Incidental Mutation 'R2391:Serpinb8'
ID 247750
Institutional Source Beutler Lab
Gene Symbol Serpinb8
Ensembl Gene ENSMUSG00000026315
Gene Name serine (or cysteine) peptidase inhibitor, clade B, member 8
Synonyms ovalbumin, CAP-2, Spi8, CAP2, NK10
MMRRC Submission 040359-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.060) question?
Stock # R2391 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 107517668-107536708 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 107534799 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 290 (D290G)
Ref Sequence ENSEMBL: ENSMUSP00000108326 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000514] [ENSMUST00000112706] [ENSMUST00000123086]
AlphaFold O08800
Predicted Effect probably damaging
Transcript: ENSMUST00000000514
AA Change: D290G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000514
Gene: ENSMUSG00000026315
AA Change: D290G

DomainStartEndE-ValueType
SERPIN 13 374 1.69e-177 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112706
AA Change: D290G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108326
Gene: ENSMUSG00000026315
AA Change: D290G

DomainStartEndE-ValueType
SERPIN 13 374 1.69e-177 SMART
Predicted Effect silent
Transcript: ENSMUST00000123086
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151283
Meta Mutation Damage Score 0.8760 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the ov-serpin family of serine protease inhibitors. The encoded protein is produced by platelets and can bind to and inhibit the function of furin, a serine protease involved in platelet functions. In addition, this protein has been found to enhance the mechanical stability of cell-cell adhesion in the skin, and defects in this gene have been associated with an autosomal-recessive form of exfoliative ichthyosis. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004F10Rik T A 7: 115,703,461 (GRCm39) D24E probably damaging Het
Abca4 A G 3: 121,952,071 (GRCm39) H689R probably benign Het
Acss3 T G 10: 106,959,348 (GRCm39) T33P probably benign Het
BC005537 T A 13: 24,993,898 (GRCm39) Y124* probably null Het
Capn2 T C 1: 182,306,174 (GRCm39) D524G probably benign Het
Catsperb A G 12: 101,590,965 (GRCm39) Y1011C probably damaging Het
Cdk18 G T 1: 132,043,212 (GRCm39) Q438K probably benign Het
Cimap1d A T 10: 79,481,484 (GRCm39) V15E probably benign Het
Ckap5 A G 2: 91,416,214 (GRCm39) M1047V possibly damaging Het
Dab1 C T 4: 104,588,948 (GRCm39) A524V probably benign Het
Dmbt1 T A 7: 130,708,198 (GRCm39) I1306N probably damaging Het
Emp2 A T 16: 10,102,452 (GRCm39) I120N probably damaging Het
Gm2888 A T 14: 3,037,656 (GRCm38) D216V possibly damaging Het
Naa16 T A 14: 79,607,489 (GRCm39) H287L probably benign Het
Olfm5 A G 7: 103,810,041 (GRCm39) S107P probably benign Het
Or10q3 G T 19: 11,848,180 (GRCm39) Y133* probably null Het
Or51e2 C A 7: 102,391,581 (GRCm39) V210F possibly damaging Het
Or6k8-ps1 T C 1: 173,979,664 (GRCm39) V194A probably benign Het
Ptpn2 A T 18: 67,808,959 (GRCm39) probably null Het
Sfmbt2 T C 2: 10,450,504 (GRCm39) Y260H possibly damaging Het
Slc6a20a A T 9: 123,493,686 (GRCm39) V65E probably damaging Het
Spon1 C T 7: 113,486,080 (GRCm39) T210M probably damaging Het
Sugp1 T C 8: 70,512,061 (GRCm39) probably null Het
Tas2r143 C A 6: 42,377,810 (GRCm39) H213Q probably damaging Het
Terf1 C A 1: 15,875,963 (GRCm39) S21* probably null Het
Trim12a T C 7: 103,956,138 (GRCm39) E134G probably damaging Het
Trip12 TATACATACATACATACATACATACATACATAC TATACATACATACATACATACATACATACATACATAC 1: 84,792,511 (GRCm39) probably null Het
Tssk5 T C 15: 76,258,751 (GRCm39) Y45C probably benign Het
Usp29 T A 7: 6,966,770 (GRCm39) probably null Het
Wdfy4 A T 14: 32,884,764 (GRCm39) M46K possibly damaging Het
Wdr90 G A 17: 26,070,429 (GRCm39) P1104L probably damaging Het
Znhit6 T C 3: 145,300,413 (GRCm39) S230P probably damaging Het
Other mutations in Serpinb8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Serpinb8 APN 1 107,534,714 (GRCm39) missense probably benign 0.01
IGL01309:Serpinb8 APN 1 107,532,448 (GRCm39) missense probably damaging 1.00
IGL03210:Serpinb8 APN 1 107,530,641 (GRCm39) missense probably damaging 1.00
Hachi UTSW 1 107,525,201 (GRCm39) start codon destroyed probably null 1.00
BB002:Serpinb8 UTSW 1 107,526,715 (GRCm39) missense probably benign 0.25
BB012:Serpinb8 UTSW 1 107,526,715 (GRCm39) missense probably benign 0.25
IGL02835:Serpinb8 UTSW 1 107,530,586 (GRCm39) missense probably damaging 1.00
R0284:Serpinb8 UTSW 1 107,530,648 (GRCm39) critical splice donor site probably null
R1087:Serpinb8 UTSW 1 107,534,727 (GRCm39) missense probably damaging 0.99
R1728:Serpinb8 UTSW 1 107,534,734 (GRCm39) missense probably benign 0.02
R1728:Serpinb8 UTSW 1 107,525,257 (GRCm39) missense probably benign
R1728:Serpinb8 UTSW 1 107,526,684 (GRCm39) missense probably benign
R1729:Serpinb8 UTSW 1 107,534,734 (GRCm39) missense probably benign 0.02
R1729:Serpinb8 UTSW 1 107,525,257 (GRCm39) missense probably benign
R1729:Serpinb8 UTSW 1 107,526,684 (GRCm39) missense probably benign
R1730:Serpinb8 UTSW 1 107,534,734 (GRCm39) missense probably benign 0.02
R1730:Serpinb8 UTSW 1 107,525,257 (GRCm39) missense probably benign
R1730:Serpinb8 UTSW 1 107,526,684 (GRCm39) missense probably benign
R1739:Serpinb8 UTSW 1 107,534,734 (GRCm39) missense probably benign 0.02
R1739:Serpinb8 UTSW 1 107,525,257 (GRCm39) missense probably benign
R1739:Serpinb8 UTSW 1 107,526,684 (GRCm39) missense probably benign
R1762:Serpinb8 UTSW 1 107,534,734 (GRCm39) missense probably benign 0.02
R1762:Serpinb8 UTSW 1 107,525,257 (GRCm39) missense probably benign
R1762:Serpinb8 UTSW 1 107,526,684 (GRCm39) missense probably benign
R1783:Serpinb8 UTSW 1 107,534,734 (GRCm39) missense probably benign 0.02
R1783:Serpinb8 UTSW 1 107,525,257 (GRCm39) missense probably benign
R1783:Serpinb8 UTSW 1 107,526,684 (GRCm39) missense probably benign
R1785:Serpinb8 UTSW 1 107,525,257 (GRCm39) missense probably benign
R1785:Serpinb8 UTSW 1 107,526,684 (GRCm39) missense probably benign
R1785:Serpinb8 UTSW 1 107,534,734 (GRCm39) missense probably benign 0.02
R2120:Serpinb8 UTSW 1 107,533,617 (GRCm39) missense probably damaging 1.00
R2146:Serpinb8 UTSW 1 107,533,657 (GRCm39) missense probably benign 0.11
R2148:Serpinb8 UTSW 1 107,533,657 (GRCm39) missense probably benign 0.11
R2897:Serpinb8 UTSW 1 107,534,776 (GRCm39) missense unknown
R2898:Serpinb8 UTSW 1 107,534,776 (GRCm39) missense unknown
R3114:Serpinb8 UTSW 1 107,535,023 (GRCm39) missense probably benign 0.09
R3697:Serpinb8 UTSW 1 107,534,876 (GRCm39) nonsense probably null
R4783:Serpinb8 UTSW 1 107,532,472 (GRCm39) missense probably benign 0.05
R5225:Serpinb8 UTSW 1 107,525,201 (GRCm39) start codon destroyed probably null 1.00
R5412:Serpinb8 UTSW 1 107,533,616 (GRCm39) missense probably benign 0.39
R5525:Serpinb8 UTSW 1 107,535,023 (GRCm39) missense probably damaging 0.99
R5554:Serpinb8 UTSW 1 107,526,705 (GRCm39) missense probably benign 0.01
R5891:Serpinb8 UTSW 1 107,533,575 (GRCm39) missense probably damaging 0.98
R6594:Serpinb8 UTSW 1 107,525,201 (GRCm39) start codon destroyed probably null 1.00
R6681:Serpinb8 UTSW 1 107,525,321 (GRCm39) missense probably damaging 1.00
R7127:Serpinb8 UTSW 1 107,525,200 (GRCm39) start codon destroyed probably null 1.00
R7151:Serpinb8 UTSW 1 107,533,527 (GRCm39) missense probably damaging 1.00
R7300:Serpinb8 UTSW 1 107,535,053 (GRCm39) makesense probably null
R7716:Serpinb8 UTSW 1 107,532,438 (GRCm39) nonsense probably null
R7807:Serpinb8 UTSW 1 107,532,457 (GRCm39) missense probably damaging 1.00
R7822:Serpinb8 UTSW 1 107,534,723 (GRCm39) nonsense probably null
R7925:Serpinb8 UTSW 1 107,526,715 (GRCm39) missense probably benign 0.25
R8210:Serpinb8 UTSW 1 107,526,736 (GRCm39) missense probably damaging 1.00
R9046:Serpinb8 UTSW 1 107,530,563 (GRCm39) missense possibly damaging 0.89
R9303:Serpinb8 UTSW 1 107,526,769 (GRCm39) critical splice donor site probably null
R9305:Serpinb8 UTSW 1 107,526,769 (GRCm39) critical splice donor site probably null
R9459:Serpinb8 UTSW 1 107,533,520 (GRCm39) nonsense probably null
X0018:Serpinb8 UTSW 1 107,525,327 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGAGCACTCCTCACTAGGTAAAG -3'
(R):5'- TGGTTCTGTTCTACAGCACC -3'

Sequencing Primer
(F):5'- CACTCCTCACTAGGTAAAGGGATAAG -3'
(R):5'- ACCGGGCGTTCCTAATCACTG -3'
Posted On 2014-11-11