Incidental Mutation 'R2406:Mybpc2'
ID248008
Institutional Source Beutler Lab
Gene Symbol Mybpc2
Ensembl Gene ENSMUSG00000038670
Gene Namemyosin binding protein C, fast-type
SynonymsFast-type C-protein
MMRRC Submission 040372-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2406 (G1)
Quality Score126
Status Validated
Chromosome7
Chromosomal Location44501699-44524656 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 44521725 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 134 (I134N)
Ref Sequence ENSEMBL: ENSMUSP00000130127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035323] [ENSMUST00000165208]
PDB Structure
Solution structure of the fibronectin type-III domain of mouse myosin-binding protein C, Fast-type homolog [SOLUTION NMR]
Solution structure of the Ig-like domain(433- 525) of murine myosin-binding protein C, fast-type [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000035323
SMART Domains Protein: ENSMUSP00000035539
Gene: ENSMUSG00000008193

DomainStartEndE-ValueType
low complexity region 50 58 N/A INTRINSIC
low complexity region 159 171 N/A INTRINSIC
ETS 173 261 2.05e-41 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000165208
AA Change: I134N

PolyPhen 2 Score 0.620 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000130127
Gene: ENSMUSG00000038670
AA Change: I134N

DomainStartEndE-ValueType
low complexity region 2 37 N/A INTRINSIC
IG 54 150 6.26e-5 SMART
PDB:2LHU|A 160 236 7e-9 PDB
low complexity region 237 252 N/A INTRINSIC
IG 258 337 5.21e-2 SMART
IG 347 430 1.2e-1 SMART
IG 440 526 2.72e-5 SMART
IG 546 631 1.68e-5 SMART
FN3 634 717 3.29e-11 SMART
FN3 732 815 1.23e-10 SMART
IG 842 925 6.07e-3 SMART
FN3 928 1010 2.08e-8 SMART
IGc2 1055 1122 6.91e-7 SMART
Meta Mutation Damage Score 0.0536 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin-binding protein C family. This family includes the fast-, slow- and cardiac-type isoforms, each of which is a myosin-associated protein found in the cross-bridge-bearing zone (C region) of A bands in striated muscle. The protein encoded by this locus is referred to as the fast-type isoform. Mutations in the related but distinct genes encoding the slow-type and cardiac-type isoforms have been associated with distal arthrogryposis, type 1 and hypertrophic cardiomyopathy, respectively. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T A 17: 35,568,455 V230E probably damaging Het
Adam22 A T 5: 8,180,064 probably benign Het
AW554918 A G 18: 25,340,287 I180V possibly damaging Het
C9 T C 15: 6,483,299 S301P possibly damaging Het
Cdc42bpb T C 12: 111,302,124 Q1214R probably benign Het
Chaf1b T C 16: 93,900,155 I351T probably damaging Het
Clip1 T C 5: 123,603,660 E1177G probably damaging Het
Colgalt1 G A 8: 71,617,668 C198Y probably damaging Het
Dennd4b C T 3: 90,275,488 R871C probably damaging Het
Eif4ebp1 A G 8: 27,273,334 I52V probably damaging Het
Fam205a1 A T 4: 42,851,696 D153E probably benign Het
Fbxw5 T C 2: 25,504,183 I86T probably damaging Het
Gm10650 A G 3: 128,039,881 noncoding transcript Het
Gm11639 A T 11: 104,720,631 D433V probably benign Het
Helz G A 11: 107,686,552 A1910T unknown Het
Hsf2 C T 10: 57,497,546 T70I probably damaging Het
Ifih1 A G 2: 62,607,103 probably benign Het
Kdm2a T C 19: 4,322,518 D933G probably damaging Het
Macc1 T C 12: 119,465,611 I832T probably damaging Het
Mapk15 T C 15: 75,998,848 S512P possibly damaging Het
Myh4 A G 11: 67,259,174 E1853G probably damaging Het
Ncoa3 T C 2: 166,055,359 V690A probably damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr1447 A G 19: 12,901,627 V51A probably benign Het
Pacsin2 A T 15: 83,385,112 probably benign Het
Piezo2 A T 18: 63,022,525 L2416Q probably damaging Het
Pip5k1c T A 10: 81,309,024 I233N probably damaging Het
Ptcd3 T C 6: 71,888,647 D428G probably damaging Het
Ptprf T C 4: 118,269,304 D84G possibly damaging Het
Rasgrf2 T C 13: 91,972,240 D798G probably benign Het
Setd7 A G 3: 51,542,676 Y110H probably damaging Het
Sgta T C 10: 81,051,247 I61M possibly damaging Het
Shank1 A G 7: 44,356,952 D2031G possibly damaging Het
Skint5 A G 4: 113,942,667 Y88H probably damaging Het
Stox1 T C 10: 62,664,166 I872V probably benign Het
Tmc4 A G 7: 3,671,026 F385L probably benign Het
Top3a A G 11: 60,756,012 F258L probably damaging Het
Ttn T C 2: 76,950,155 Y1084C probably damaging Het
Ubtf A T 11: 102,308,702 Y504* probably null Het
Wdfy3 T C 5: 101,888,259 T2098A probably damaging Het
Wnk2 G T 13: 49,061,488 T1194K possibly damaging Het
Zbtb40 T A 4: 136,998,568 E560V probably benign Het
Other mutations in Mybpc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Mybpc2 APN 7 44505405 unclassified probably benign
IGL00586:Mybpc2 APN 7 44505382 missense probably damaging 0.96
IGL00976:Mybpc2 APN 7 44522317 splice site probably null
IGL01099:Mybpc2 APN 7 44516167 missense probably damaging 0.99
IGL01348:Mybpc2 APN 7 44515928 missense probably benign
IGL01625:Mybpc2 APN 7 44516913 missense possibly damaging 0.65
IGL01733:Mybpc2 APN 7 44506198 missense probably benign 0.03
IGL01946:Mybpc2 APN 7 44509898 unclassified probably benign
IGL02078:Mybpc2 APN 7 44503780 missense probably damaging 1.00
IGL02314:Mybpc2 APN 7 44522388 missense possibly damaging 0.82
IGL02341:Mybpc2 APN 7 44514930 missense probably benign 0.00
IGL02904:Mybpc2 APN 7 44522341 missense probably benign 0.05
IGL03034:Mybpc2 APN 7 44511897 missense possibly damaging 0.87
IGL03296:Mybpc2 APN 7 44506884 missense probably damaging 1.00
R0094:Mybpc2 UTSW 7 44516904 missense probably damaging 1.00
R0329:Mybpc2 UTSW 7 44509029 missense possibly damaging 0.94
R0330:Mybpc2 UTSW 7 44509029 missense possibly damaging 0.94
R0336:Mybpc2 UTSW 7 44505616 missense probably damaging 1.00
R0503:Mybpc2 UTSW 7 44512570 unclassified probably benign
R0821:Mybpc2 UTSW 7 44506887 missense probably benign 0.02
R0822:Mybpc2 UTSW 7 44506887 missense probably benign 0.02
R0823:Mybpc2 UTSW 7 44506887 missense probably benign 0.02
R0854:Mybpc2 UTSW 7 44517002 missense probably benign 0.06
R0938:Mybpc2 UTSW 7 44506887 missense probably benign 0.02
R0939:Mybpc2 UTSW 7 44506887 missense probably benign 0.02
R0940:Mybpc2 UTSW 7 44506887 missense probably benign 0.02
R0941:Mybpc2 UTSW 7 44506887 missense probably benign 0.02
R1166:Mybpc2 UTSW 7 44505025 missense possibly damaging 0.84
R1219:Mybpc2 UTSW 7 44516034 splice site probably null
R1559:Mybpc2 UTSW 7 44513687 missense probably benign 0.01
R1732:Mybpc2 UTSW 7 44513675 missense probably benign
R1802:Mybpc2 UTSW 7 44512470 missense possibly damaging 0.81
R2157:Mybpc2 UTSW 7 44509845 missense possibly damaging 0.93
R2216:Mybpc2 UTSW 7 44512500 unclassified probably null
R2411:Mybpc2 UTSW 7 44506238 missense probably damaging 1.00
R3079:Mybpc2 UTSW 7 44506081 missense probably damaging 1.00
R4663:Mybpc2 UTSW 7 44505642 missense probably damaging 0.99
R4736:Mybpc2 UTSW 7 44512547 missense probably damaging 1.00
R5316:Mybpc2 UTSW 7 44520382 nonsense probably null
R5426:Mybpc2 UTSW 7 44509829 missense probably benign 0.01
R5498:Mybpc2 UTSW 7 44516265 missense probably damaging 1.00
R5539:Mybpc2 UTSW 7 44514893 missense probably benign 0.17
R5644:Mybpc2 UTSW 7 44507053 missense probably benign 0.13
R5909:Mybpc2 UTSW 7 44507091 missense probably damaging 1.00
R6435:Mybpc2 UTSW 7 44506057 missense possibly damaging 0.73
R6662:Mybpc2 UTSW 7 44506166 missense probably benign
R6901:Mybpc2 UTSW 7 44505355 missense probably damaging 0.99
R7188:Mybpc2 UTSW 7 44506193 missense probably benign 0.06
R7389:Mybpc2 UTSW 7 44505604 missense probably benign 0.11
R7405:Mybpc2 UTSW 7 44507194 missense probably damaging 1.00
R7553:Mybpc2 UTSW 7 44506147 missense possibly damaging 0.51
X0052:Mybpc2 UTSW 7 44507142 missense probably benign 0.23
X0065:Mybpc2 UTSW 7 44505385 missense probably benign 0.01
Z1088:Mybpc2 UTSW 7 44516503 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- CTCCTATGCAAAGCCTGGAG -3'
(R):5'- GATCTACAGCGCGGACTAACTAG -3'

Sequencing Primer
(F):5'- TATGCAAAGCCTGGAGACCTTGTC -3'
(R):5'- ACTAACTAGGGCCGGCTG -3'
Posted On2014-11-11