Mutagenetix > Incidental Mutations

Incidental Mutation 'R8830:Mybpc2'

673744

Institutional Source

Beutler Lab

Gene Symbol

Mybpc2

Ensembl Gene

ENSMUSG00000038670

Gene Name

myosin binding protein C, fast-type

Synonyms

Fast-type C-protein

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8830 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

44501699-44524656 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 44512541 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 495 (V495D)

Ref Sequence

ENSEMBL: ENSMUSP00000130127 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000165208]

AlphaFold

Q5XKE0

PDB Structure

Solution structure of the fibronectin type-III domain of mouse myosin-binding protein C, Fast-type homolog [SOLUTION NMR]
Solution structure of the Ig-like domain(433- 525) of murine myosin-binding protein C, fast-type [SOLUTION NMR]

Predicted Effect

probably damaging
Transcript: ENSMUST00000165208
AA Change: V495D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000130127
Gene: ENSMUSG00000038670
AA Change: V495D

Domain	Start	End	E-Value	Type
low complexity region	2	37	N/A	INTRINSIC
IG	54	150	6.26e-5	SMART
PDB:2LHU\|A	160	236	7e-9	PDB
low complexity region	237	252	N/A	INTRINSIC
IG	258	337	5.21e-2	SMART
IG	347	430	1.2e-1	SMART
IG	440	526	2.72e-5	SMART
IG	546	631	1.68e-5	SMART
FN3	634	717	3.29e-11	SMART
FN3	732	815	1.23e-10	SMART
IG	842	925	6.07e-3	SMART
FN3	928	1010	2.08e-8	SMART
IGc2	1055	1122	6.91e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000207516

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

100% (68/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin-binding protein C family. This family includes the fast-, slow- and cardiac-type isoforms, each of which is a myosin-associated protein found in the cross-bridge-bearing zone (C region) of A bands in striated muscle. The protein encoded by this locus is referred to as the fast-type isoform. Mutations in the related but distinct genes encoding the slow-type and cardiac-type isoforms have been associated with distal arthrogryposis, type 1 and hypertrophic cardiomyopathy, respectively. [provided by RefSeq, Jul 2012]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aaed1	G	A	13: 64,297,300	Q170*	probably null	Het
Abca7	T	A	10: 80,008,971	V1509E	probably damaging	Het
Abraxas2	A	G	7: 132,883,356	D376G	probably damaging	Het
Agbl1	A	G	7: 76,335,311	T159A		Het
Ahnak2	G	A	12: 112,787,036	R89W		Het
Arhgef40	A	C	14: 52,003,708	D1396A	probably damaging	Het
Atp13a5	A	T	16: 29,248,176	F1060I	probably damaging	Het
Atp6v1c1	T	A	15: 38,677,545	F105I	probably damaging	Het
Atp9b	C	T	18: 80,765,800	E635K		Het
BC017643	C	T	11: 121,228,723		probably benign	Het
Brix1	T	A	15: 10,479,596	Q124L	possibly damaging	Het
Cep68	A	G	11: 20,230,418		probably benign	Het
Cfap46	A	G	7: 139,615,649	S2208P	unknown	Het
Crisp1	T	A	17: 40,294,419	K234*	probably null	Het
Cryzl1	C	T	16: 91,712,204	V70I	probably benign	Het
Dnah7b	T	C	1: 46,191,793	Y1404H	probably damaging	Het
Dot1l	A	G	10: 80,771,199	H109R	possibly damaging	Het
E330034G19Rik	A	C	14: 24,309,508	H329P	unknown	Het
Erbb4	A	T	1: 68,075,468	L939Q	probably damaging	Het
Fst	A	T	13: 114,455,828	C118S	probably damaging	Het
Gfra3	A	G	18: 34,711,136	V117A	possibly damaging	Het
Gldc	C	G	19: 30,100,812	M928I	probably benign	Het
Gm5538	A	T	3: 59,747,323	T193S	probably benign	Het
Gm996	T	G	2: 25,577,250	D883A		Het
Greb1	A	G	12: 16,688,519	M1481T	probably benign	Het
Hecw2	G	A	1: 53,891,146	R1045C	probably damaging	Het
Hexb	C	T	13: 97,194,254	V84I	probably benign	Het
Hpse	T	C	5: 100,695,586	E240G	probably benign	Het
Hspa12a	T	C	19: 58,805,463	D322G	possibly damaging	Het
Hspa9	A	T	18: 34,948,104		probably null	Het
Kif9	A	G	9: 110,524,930	K790R	probably damaging	Het
Klc2	C	T	19: 5,110,366		probably null	Het
Ldha	C	G	7: 46,850,278	N144K	probably benign	Het
Micalcl	A	G	7: 112,381,196	T126A	probably benign	Het
Mrpl15	A	T	1: 4,782,584	V137D	probably damaging	Het
Muc16	G	A	9: 18,646,069	T2976I	unknown	Het
Olfr597	A	G	7: 103,321,005	K198R		Het
Olfr713	A	G	7: 107,036,682	N176D	probably benign	Het
Olfr772	A	T	10: 129,174,846	Y58*	probably null	Het
Pcnt	G	A	10: 76,382,174	T2089I	probably benign	Het
Pdzd7	T	C	19: 45,033,073	D563G	probably damaging	Het
Phlpp1	T	G	1: 106,350,603	L915R	probably damaging	Het
Plekhh2	T	A	17: 84,521,803	I34N	probably damaging	Het
Pou6f2	T	A	13: 18,378,498	T84S		Het
Ptprq	A	G	10: 107,586,695	V1612A	possibly damaging	Het
Pvrig	T	G	5: 138,342,148		probably benign	Het
Rasl10b	A	T	11: 83,412,676	I20F	probably damaging	Het
Rimbp3	T	A	16: 17,209,006	V98E	probably damaging	Het
Rims2	T	C	15: 39,437,362	I355T	possibly damaging	Het
Slc1a2	A	G	2: 102,736,015	H30R	probably benign	Het
Slc28a1	G	A	7: 81,161,046	V389M	possibly damaging	Het
Slc7a13	T	C	4: 19,819,189	S130P	probably benign	Het
Sp140	TTTTTTTT	TTTTTTTTTTTTT	1: 85,644,574		probably benign	Het
Spag17	T	A	3: 100,125,435	H2320Q	possibly damaging	Het
Speer4a	T	C	5: 26,036,795	E111G	possibly damaging	Het
Ss18l1	T	C	2: 180,067,338	Y397H	unknown	Het
Tbck	T	C	3: 132,838,057	S890P	probably damaging	Het
Tcp11	T	C	17: 28,080,230	E17G	probably benign	Het
Tesk2	C	T	4: 116,802,287	R315C	probably benign	Het
Tln1	T	C	4: 43,556,383	N45S	probably benign	Het
Trim10	C	T	17: 36,869,954	P26S	probably damaging	Het
Vmac	C	A	17: 56,715,573	G146C	probably damaging	Het
Vmn1r14	G	A	6: 57,234,032	M198I	probably damaging	Het
Vmn1r194	T	C	13: 22,244,836	Y208H	possibly damaging	Het
Vmn1r78	G	A	7: 12,153,191	C243Y	probably damaging	Het
Wasf3	C	T	5: 146,466,862	Q261*	probably null	Het
Ybx2	A	G	11: 69,936,237	K88R	probably benign	Het
Zfhx4	G	A	3: 5,398,889	R1394H	probably damaging	Het
Zfp871	T	C	17: 32,774,927	T425A	probably benign	Het
Zfy2	C	T	Y: 2,106,600	S678N	possibly damaging	Het
Zswim4	T	C	8: 84,223,316	E650G	possibly damaging	Het

Other mutations in Mybpc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00516:Mybpc2	APN	7	44505405	unclassified	probably benign
IGL00586:Mybpc2	APN	7	44505382	missense	probably damaging	0.96
IGL00976:Mybpc2	APN	7	44522317	splice site	probably null
IGL01099:Mybpc2	APN	7	44516167	missense	probably damaging	0.99
IGL01348:Mybpc2	APN	7	44515928	missense	probably benign
IGL01625:Mybpc2	APN	7	44516913	missense	possibly damaging	0.65
IGL01733:Mybpc2	APN	7	44506198	missense	probably benign	0.03
IGL01946:Mybpc2	APN	7	44509898	unclassified	probably benign
IGL02078:Mybpc2	APN	7	44503780	missense	probably damaging	1.00
IGL02314:Mybpc2	APN	7	44522388	missense	possibly damaging	0.82
IGL02341:Mybpc2	APN	7	44514930	missense	probably benign	0.00
IGL02904:Mybpc2	APN	7	44522341	missense	probably benign	0.05
IGL03034:Mybpc2	APN	7	44511897	missense	possibly damaging	0.87
IGL03296:Mybpc2	APN	7	44506884	missense	probably damaging	1.00
R0094:Mybpc2	UTSW	7	44516904	missense	probably damaging	1.00
R0329:Mybpc2	UTSW	7	44509029	missense	possibly damaging	0.94
R0330:Mybpc2	UTSW	7	44509029	missense	possibly damaging	0.94
R0336:Mybpc2	UTSW	7	44505616	missense	probably damaging	1.00
R0503:Mybpc2	UTSW	7	44512570	unclassified	probably benign
R0821:Mybpc2	UTSW	7	44506887	missense	probably benign	0.02
R0822:Mybpc2	UTSW	7	44506887	missense	probably benign	0.02
R0823:Mybpc2	UTSW	7	44506887	missense	probably benign	0.02
R0854:Mybpc2	UTSW	7	44517002	missense	probably benign	0.06
R0938:Mybpc2	UTSW	7	44506887	missense	probably benign	0.02
R0939:Mybpc2	UTSW	7	44506887	missense	probably benign	0.02
R0940:Mybpc2	UTSW	7	44506887	missense	probably benign	0.02
R0941:Mybpc2	UTSW	7	44506887	missense	probably benign	0.02
R1166:Mybpc2	UTSW	7	44505025	missense	possibly damaging	0.84
R1219:Mybpc2	UTSW	7	44516034	splice site	probably null
R1559:Mybpc2	UTSW	7	44513687	missense	probably benign	0.01
R1732:Mybpc2	UTSW	7	44513675	missense	probably benign
R1802:Mybpc2	UTSW	7	44512470	missense	possibly damaging	0.81
R2157:Mybpc2	UTSW	7	44509845	missense	possibly damaging	0.93
R2216:Mybpc2	UTSW	7	44512500	splice site	probably null
R2406:Mybpc2	UTSW	7	44521725	missense	possibly damaging	0.62
R2411:Mybpc2	UTSW	7	44506238	missense	probably damaging	1.00
R3079:Mybpc2	UTSW	7	44506081	missense	probably damaging	1.00
R4663:Mybpc2	UTSW	7	44505642	missense	probably damaging	0.99
R4736:Mybpc2	UTSW	7	44512547	missense	probably damaging	1.00
R5316:Mybpc2	UTSW	7	44520382	nonsense	probably null
R5426:Mybpc2	UTSW	7	44509829	missense	probably benign	0.01
R5498:Mybpc2	UTSW	7	44516265	missense	probably damaging	1.00
R5539:Mybpc2	UTSW	7	44514893	missense	probably benign	0.17
R5644:Mybpc2	UTSW	7	44507053	missense	probably benign	0.13
R5909:Mybpc2	UTSW	7	44507091	missense	probably damaging	1.00
R6435:Mybpc2	UTSW	7	44506057	missense	possibly damaging	0.73
R6662:Mybpc2	UTSW	7	44506166	missense	probably benign
R6901:Mybpc2	UTSW	7	44505355	missense	probably damaging	0.99
R7188:Mybpc2	UTSW	7	44506193	missense	probably benign	0.06
R7389:Mybpc2	UTSW	7	44505604	missense	probably benign	0.11
R7405:Mybpc2	UTSW	7	44507194	missense	probably damaging	1.00
R7553:Mybpc2	UTSW	7	44506147	missense	possibly damaging	0.51
R7597:Mybpc2	UTSW	7	44509799	missense	probably damaging	1.00
R7772:Mybpc2	UTSW	7	44515924	critical splice donor site	probably null
R7824:Mybpc2	UTSW	7	44504860	splice site	probably null
R8003:Mybpc2	UTSW	7	44509064	missense	probably damaging	0.99
R8179:Mybpc2	UTSW	7	44509830	missense	probably benign	0.01
R8187:Mybpc2	UTSW	7	44512470	missense	possibly damaging	0.81
R8413:Mybpc2	UTSW	7	44508305	missense	probably damaging	1.00
R8729:Mybpc2	UTSW	7	44506187	missense	probably damaging	1.00
R9377:Mybpc2	UTSW	7	44509575	missense	probably benign	0.22
R9441:Mybpc2	UTSW	7	44516906	missense	probably null	0.96
X0052:Mybpc2	UTSW	7	44507142	missense	probably benign	0.23
X0065:Mybpc2	UTSW	7	44505385	missense	probably benign	0.01
Z1088:Mybpc2	UTSW	7	44516503	missense	possibly damaging	0.47
Z1176:Mybpc2	UTSW	7	44521696	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CTATGACCTCCATAGCAACTAGG -3'
(R):5'- GCTCCCTGCTAGATGTCTCT -3'

Sequencing Primer
(F):5'- CTCCATAGCAACTAGGGATCTC -3'
(R):5'- CCTAGCTTACTTGATGAGACCAGG -3'

Posted On

2021-07-15