Incidental Mutation 'R2475:Atic'
ID253312
Institutional Source Beutler Lab
Gene Symbol Atic
Ensembl Gene ENSMUSG00000026192
Gene Name5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase
Synonyms2610509C24Rik
MMRRC Submission 040406-MU
Accession Numbers

Genbank: NM_026195; MGI: 1351352

Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R2475 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location71557150-71579631 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 71559269 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 64 (R64C)
Ref Sequence ENSEMBL: ENSMUSP00000027384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027384]
Predicted Effect probably damaging
Transcript: ENSMUST00000027384
AA Change: R64C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027384
Gene: ENSMUSG00000026192
AA Change: R64C

DomainStartEndE-ValueType
MGS 16 130 1.31e-46 SMART
AICARFT_IMPCHas 135 462 4.84e-132 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136443
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148077
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155769
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187982
Meta Mutation Damage Score 0.9624 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a bifunctional protein that catalyzes the last two steps of the de novo purine biosynthetic pathway. The N-terminal domain has phosphoribosylaminoimidazolecarboxamide formyltransferase activity, and the C-terminal domain has IMP cyclohydrolase activity. A mutation in this gene results in AICA-ribosiduria. [provided by RefSeq, Sep 2009]
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1a1 T A 19: 20,640,078 M458K probably benign Het
Atp7b C T 8: 21,994,776 V1307M possibly damaging Het
Bbx C A 16: 50,220,519 R707L probably damaging Het
Ccdc28b A T 4: 129,620,652 probably null Het
Gm13078 T A 4: 143,726,825 Y168N probably benign Het
Gm21136 T A 7: 38,867,834 T57S probably damaging Het
Gm5862 G A 5: 26,019,492 L160F probably damaging Het
Gpsm3 A G 17: 34,590,560 T47A possibly damaging Het
Grip1 T C 10: 119,978,496 Y311H probably benign Het
Inpp4b T A 8: 82,041,978 N705K probably benign Het
Lingo1 T A 9: 56,619,626 I560F probably benign Het
Man2b2 A G 5: 36,807,875 V958A probably benign Het
Mavs G T 2: 131,240,450 A85S probably damaging Het
Nipbl A T 15: 8,335,006 C1305S probably benign Het
Olfr112 A G 17: 37,563,711 V200A probably benign Het
Phf19 C T 2: 34,895,795 R554Q probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Trpm8 A G 1: 88,354,449 D689G probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ttn A G 2: 76,872,750 probably benign Het
Wrnip1 G A 13: 32,806,958 R400H probably benign Het
Other mutations in Atic
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01947:Atic APN 1 71570837 splice site probably benign
IGL02368:Atic APN 1 71564565 splice site probably benign
IGL03291:Atic APN 1 71570922 missense probably benign 0.06
3-1:Atic UTSW 1 71560895 nonsense probably null
R0039:Atic UTSW 1 71577850 missense possibly damaging 0.95
R0039:Atic UTSW 1 71577850 missense possibly damaging 0.95
R0558:Atic UTSW 1 71563788 missense probably benign 0.00
R1222:Atic UTSW 1 71559279 missense probably damaging 1.00
R1662:Atic UTSW 1 71576127 missense probably benign 0.06
R2075:Atic UTSW 1 71576127 missense probably benign 0.06
R2402:Atic UTSW 1 71569057 nonsense probably null
R2566:Atic UTSW 1 71568971 missense probably damaging 0.98
R3711:Atic UTSW 1 71578579 missense probably benign 0.02
R5115:Atic UTSW 1 71557275 critical splice donor site probably null
R5215:Atic UTSW 1 71564507 missense probably damaging 0.98
R5444:Atic UTSW 1 71576717 missense probably damaging 0.96
R6348:Atic UTSW 1 71576698 missense probably damaging 1.00
R6370:Atic UTSW 1 71578660 missense probably damaging 1.00
R6374:Atic UTSW 1 71564941 missense probably damaging 1.00
R6909:Atic UTSW 1 71576846 intron probably null
R7224:Atic UTSW 1 71570855 missense probably benign
R7444:Atic UTSW 1 71563787 missense probably benign 0.05
R7724:Atic UTSW 1 71564901 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACATTGTAAAGCCAGTGC -3'
(R):5'- ACTTATCCTGTAGTGAGGAGTCAG -3'

Sequencing Primer
(F):5'- ACATTTAGGAAATCCAACACAGTG -3'
(R):5'- TGAGGAGTCAGATTATAAAGGGATC -3'
Posted On2014-12-04