Incidental Mutation 'R2979:Synm'
ID257039
Institutional Source Beutler Lab
Gene Symbol Synm
Ensembl Gene ENSMUSG00000030554
Gene Namesynemin, intermediate filament protein
Synonyms4930412K21Rik, Dmn, Synemin
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2979 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location67730160-67759742 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 67736260 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 551 (R551S)
Ref Sequence ENSEMBL: ENSMUSP00000147111 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051389] [ENSMUST00000074233] [ENSMUST00000207102] [ENSMUST00000208231] [ENSMUST00000208815]
Predicted Effect probably damaging
Transcript: ENSMUST00000051389
AA Change: R551S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050987
Gene: ENSMUSG00000030554
AA Change: R551S

DomainStartEndE-ValueType
Pfam:Filament 10 321 2.7e-38 PFAM
low complexity region 1248 1257 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000074233
AA Change: R551S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073855
Gene: ENSMUSG00000030554
AA Change: R551S

DomainStartEndE-ValueType
Filament 10 321 6.4e-38 SMART
internal_repeat_1 1089 1185 3.03e-7 PROSPERO
internal_repeat_1 1351 1454 3.03e-7 PROSPERO
low complexity region 1550 1559 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000207102
AA Change: R109S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000208231
Predicted Effect probably benign
Transcript: ENSMUST00000208764
Predicted Effect probably damaging
Transcript: ENSMUST00000208815
AA Change: R551S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an intermediate filament (IF) family member. IF proteins are cytoskeletal proteins that confer resistance to mechanical stress and are encoded by a dispersed multigene family. This protein has been found to form a linkage between desmin, which is a subunit of the IF network, and the extracellular matrix, and provides an important structural support in muscle. Two alternatively spliced variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a mild skeletal muscle phenotype characterized by abnormal muscle fiber morphology and increased sarcolemmal deformability and susceptibility to injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afm A G 5: 90,522,163 I48V probably benign Het
Arhgef1 A G 7: 24,907,751 E16G unknown Het
Cps1 T C 1: 67,204,704 probably null Het
Dnah9 T C 11: 66,117,588 K804E possibly damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Gm18025 G T 12: 34,290,971 P41Q probably damaging Het
Kdm4c A T 4: 74,373,728 R861* probably null Het
Klhl2 C T 8: 64,823,078 V58I probably damaging Het
Msl1 G A 11: 98,800,224 G178E possibly damaging Het
Nacad T A 11: 6,601,424 Q589L probably benign Het
Pros1 A G 16: 62,913,866 D345G probably damaging Het
Sh3tc2 A G 18: 61,989,485 Y439C probably damaging Het
Smarcad1 T A 6: 65,075,011 M376K probably benign Het
Srd5a1 T C 13: 69,600,299 Q127R probably damaging Het
Trmt1 A G 8: 84,696,882 Y301C probably damaging Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Txnl1 T C 18: 63,671,620 T268A probably benign Het
Zbbx C A 3: 75,078,486 E420* probably null Het
Zc3h7a A T 16: 11,158,973 V153E probably damaging Het
Other mutations in Synm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Synm APN 7 67734915 missense probably benign 0.01
IGL01567:Synm APN 7 67735232 missense probably damaging 0.99
IGL01867:Synm APN 7 67733474 missense probably benign 0.13
IGL01870:Synm APN 7 67736118 missense possibly damaging 0.86
IGL01951:Synm APN 7 67739137 missense probably damaging 1.00
IGL02264:Synm APN 7 67734396 missense probably damaging 0.99
IGL02892:Synm APN 7 67735056 missense probably damaging 1.00
PIT4449001:Synm UTSW 7 67735277 missense probably benign
R0032:Synm UTSW 7 67733927 missense possibly damaging 0.90
R0194:Synm UTSW 7 67734924 missense probably damaging 1.00
R0345:Synm UTSW 7 67735821 missense probably benign 0.13
R0453:Synm UTSW 7 67736882 missense possibly damaging 0.92
R0646:Synm UTSW 7 67759168 missense probably benign 0.07
R0847:Synm UTSW 7 67735056 missense probably damaging 1.00
R0919:Synm UTSW 7 67735347 missense probably damaging 1.00
R1484:Synm UTSW 7 67736332 missense probably damaging 1.00
R1700:Synm UTSW 7 67759628 start codon destroyed probably null 0.98
R1715:Synm UTSW 7 67736303 missense probably damaging 1.00
R1796:Synm UTSW 7 67734000 missense possibly damaging 0.77
R1799:Synm UTSW 7 67735959 missense probably damaging 1.00
R2116:Synm UTSW 7 67733595 missense probably benign 0.18
R4116:Synm UTSW 7 67734657 missense possibly damaging 0.50
R4172:Synm UTSW 7 67735361 missense probably damaging 1.00
R4981:Synm UTSW 7 67734487 missense probably benign 0.02
R5114:Synm UTSW 7 67735658 missense probably damaging 1.00
R5276:Synm UTSW 7 67734689 missense probably benign 0.08
R5446:Synm UTSW 7 67735974 missense probably benign 0.17
R5592:Synm UTSW 7 67759516 missense probably damaging 1.00
R5960:Synm UTSW 7 67735746 missense probably damaging 1.00
R6025:Synm UTSW 7 67734938 missense possibly damaging 0.78
R6034:Synm UTSW 7 67734905 missense probably damaging 1.00
R6034:Synm UTSW 7 67734905 missense probably damaging 1.00
R6445:Synm UTSW 7 67733645 missense probably benign
R6446:Synm UTSW 7 67734966 missense probably damaging 1.00
R6492:Synm UTSW 7 67736061 missense probably benign 0.00
R6526:Synm UTSW 7 67735583 missense possibly damaging 0.62
R6612:Synm UTSW 7 67733516 missense probably damaging 0.99
R6646:Synm UTSW 7 67735127 missense probably damaging 1.00
R6708:Synm UTSW 7 67733246 missense possibly damaging 0.72
R6957:Synm UTSW 7 67736100 missense probably benign 0.28
R6988:Synm UTSW 7 67733658 missense probably damaging 1.00
R7208:Synm UTSW 7 67734915 missense probably benign 0.01
R7320:Synm UTSW 7 67735380 missense possibly damaging 0.89
R7417:Synm UTSW 7 67733206 makesense probably null
R7425:Synm UTSW 7 67733446 missense probably damaging 0.99
R7468:Synm UTSW 7 67733223 missense unknown
R7782:Synm UTSW 7 67734966 missense probably damaging 1.00
R7826:Synm UTSW 7 67735589 missense probably damaging 1.00
Z1088:Synm UTSW 7 67751886 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCGGAACCTTGTCTCTTTG -3'
(R):5'- CTCCGTCAAATGAGAGGACTG -3'

Sequencing Primer
(F):5'- GGAACCTTGTCTCTTTGGTCTCTG -3'
(R):5'- AATGAGAGGACTGTCATTCTGG -3'
Posted On2015-01-11