Incidental Mutation 'R6445:Synm'
ID519161
Institutional Source Beutler Lab
Gene Symbol Synm
Ensembl Gene ENSMUSG00000030554
Gene Namesynemin, intermediate filament protein
Synonyms4930412K21Rik, Dmn, Synemin
MMRRC Submission 044388-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6445 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location67730160-67759742 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67733645 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1423 (V1423A)
Ref Sequence ENSEMBL: ENSMUSP00000073855 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051389] [ENSMUST00000074233] [ENSMUST00000207102] [ENSMUST00000208231] [ENSMUST00000208815]
Predicted Effect probably benign
Transcript: ENSMUST00000051389
SMART Domains Protein: ENSMUSP00000050987
Gene: ENSMUSG00000030554

DomainStartEndE-ValueType
Pfam:Filament 10 321 2.7e-38 PFAM
low complexity region 1248 1257 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000074233
AA Change: V1423A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000073855
Gene: ENSMUSG00000030554
AA Change: V1423A

DomainStartEndE-ValueType
Filament 10 321 6.4e-38 SMART
internal_repeat_1 1089 1185 3.03e-7 PROSPERO
internal_repeat_1 1351 1454 3.03e-7 PROSPERO
low complexity region 1550 1559 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207102
Predicted Effect probably benign
Transcript: ENSMUST00000208231
Predicted Effect probably benign
Transcript: ENSMUST00000208764
Predicted Effect probably benign
Transcript: ENSMUST00000208815
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.2%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an intermediate filament (IF) family member. IF proteins are cytoskeletal proteins that confer resistance to mechanical stress and are encoded by a dispersed multigene family. This protein has been found to form a linkage between desmin, which is a subunit of the IF network, and the extracellular matrix, and provides an important structural support in muscle. Two alternatively spliced variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a mild skeletal muscle phenotype characterized by abnormal muscle fiber morphology and increased sarcolemmal deformability and susceptibility to injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
BC061237 C A 14: 44,501,274 D43E probably benign Het
Cdh22 T C 2: 165,170,692 I158V probably damaging Het
Cntrl A G 2: 35,162,848 I1676V probably benign Het
Crem T C 18: 3,309,671 Y18C probably benign Het
Cyp2b9 A G 7: 26,186,987 I146V probably benign Het
Efcab14 C A 4: 115,756,471 H205Q possibly damaging Het
Efcab6 T C 15: 83,868,357 Y1437C probably damaging Het
Gm3055 T A 10: 82,109,672 N375K possibly damaging Het
Gm36864 A T 7: 44,237,418 Q245L possibly damaging Het
Gna11 A T 10: 81,533,333 I132N probably damaging Het
Ikzf4 C A 10: 128,636,555 probably null Het
Il9r C T 11: 32,191,000 G346D possibly damaging Het
Krt71 C T 15: 101,740,340 R190Q probably benign Het
Mfsd8 T C 3: 40,837,118 I54V probably damaging Het
Nktr G T 9: 121,748,414 probably benign Het
Olfr199 A T 16: 59,216,109 F168Y probably damaging Het
Olfr562-ps1 T C 7: 102,782,258 S261P probably benign Het
Peli2 T C 14: 48,256,448 S376P possibly damaging Het
Pik3r2 C T 8: 70,772,026 A202T probably benign Het
Pms1 A T 1: 53,192,194 I832K possibly damaging Het
Reln T C 5: 21,919,214 K2765E probably benign Het
Rp1 A T 1: 4,226,617 N744K unknown Het
Smcr8 T C 11: 60,779,015 Y330H possibly damaging Het
Sned1 A T 1: 93,283,596 R281S possibly damaging Het
Syt10 G A 15: 89,814,268 T291I probably damaging Het
Ttn T C 2: 76,914,536 probably benign Het
Wdr3 T C 3: 100,156,403 T186A possibly damaging Het
Zfp451 A C 1: 33,773,011 D874E probably damaging Het
Other mutations in Synm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Synm APN 7 67734915 missense probably benign 0.01
IGL01567:Synm APN 7 67735232 missense probably damaging 0.99
IGL01867:Synm APN 7 67733474 missense probably benign 0.13
IGL01870:Synm APN 7 67736118 missense possibly damaging 0.86
IGL01951:Synm APN 7 67739137 missense probably damaging 1.00
IGL02264:Synm APN 7 67734396 missense probably damaging 0.99
IGL02892:Synm APN 7 67735056 missense probably damaging 1.00
PIT4449001:Synm UTSW 7 67735277 missense probably benign
R0032:Synm UTSW 7 67733927 missense possibly damaging 0.90
R0194:Synm UTSW 7 67734924 missense probably damaging 1.00
R0345:Synm UTSW 7 67735821 missense probably benign 0.13
R0453:Synm UTSW 7 67736882 missense possibly damaging 0.92
R0646:Synm UTSW 7 67759168 missense probably benign 0.07
R0847:Synm UTSW 7 67735056 missense probably damaging 1.00
R0919:Synm UTSW 7 67735347 missense probably damaging 1.00
R1484:Synm UTSW 7 67736332 missense probably damaging 1.00
R1700:Synm UTSW 7 67759628 start codon destroyed probably null 0.98
R1715:Synm UTSW 7 67736303 missense probably damaging 1.00
R1796:Synm UTSW 7 67734000 missense possibly damaging 0.77
R1799:Synm UTSW 7 67735959 missense probably damaging 1.00
R2116:Synm UTSW 7 67733595 missense probably benign 0.18
R2979:Synm UTSW 7 67736260 missense probably damaging 1.00
R4116:Synm UTSW 7 67734657 missense possibly damaging 0.50
R4172:Synm UTSW 7 67735361 missense probably damaging 1.00
R4981:Synm UTSW 7 67734487 missense probably benign 0.02
R5114:Synm UTSW 7 67735658 missense probably damaging 1.00
R5276:Synm UTSW 7 67734689 missense probably benign 0.08
R5446:Synm UTSW 7 67735974 missense probably benign 0.17
R5592:Synm UTSW 7 67759516 missense probably damaging 1.00
R5960:Synm UTSW 7 67735746 missense probably damaging 1.00
R6025:Synm UTSW 7 67734938 missense possibly damaging 0.78
R6034:Synm UTSW 7 67734905 missense probably damaging 1.00
R6034:Synm UTSW 7 67734905 missense probably damaging 1.00
R6446:Synm UTSW 7 67734966 missense probably damaging 1.00
R6492:Synm UTSW 7 67736061 missense probably benign 0.00
R6526:Synm UTSW 7 67735583 missense possibly damaging 0.62
R6612:Synm UTSW 7 67733516 missense probably damaging 0.99
R6646:Synm UTSW 7 67735127 missense probably damaging 1.00
R6708:Synm UTSW 7 67733246 missense possibly damaging 0.72
R6957:Synm UTSW 7 67736100 missense probably benign 0.28
R6988:Synm UTSW 7 67733658 missense probably damaging 1.00
R7208:Synm UTSW 7 67734915 missense probably benign 0.01
R7320:Synm UTSW 7 67735380 missense possibly damaging 0.89
R7417:Synm UTSW 7 67733206 makesense probably null
R7425:Synm UTSW 7 67733446 missense probably damaging 0.99
R7468:Synm UTSW 7 67733223 missense unknown
R7782:Synm UTSW 7 67734966 missense probably damaging 1.00
R7826:Synm UTSW 7 67735589 missense probably damaging 1.00
Z1088:Synm UTSW 7 67751886 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTGCAATTCTCCAGCCAC -3'
(R):5'- TCCAGGCCACTCACAATTTC -3'

Sequencing Primer
(F):5'- ATTCTCCAGCCACCACGGTG -3'
(R):5'- GAACACATTCCAGAGGGTCATTTCTG -3'
Posted On2018-05-24