Incidental Mutation 'R2981:Trim58'
ID257081
Institutional Source Beutler Lab
Gene Symbol Trim58
Ensembl Gene ENSMUSG00000037124
Gene Nametripartite motif-containing 58
SynonymsLOC386443, LOC216781
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R2981 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location58640465-58652404 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 58651561 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 449 (V449D)
Ref Sequence ENSEMBL: ENSMUSP00000074594 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075084]
Predicted Effect probably damaging
Transcript: ENSMUST00000075084
AA Change: V449D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000074594
Gene: ENSMUSG00000037124
AA Change: V449D

DomainStartEndE-ValueType
RING 15 58 2.95e-7 SMART
BBOX 90 131 2.93e-11 SMART
coiled coil region 192 241 N/A INTRINSIC
PRY 289 341 5.33e-23 SMART
SPRY 342 461 6.16e-29 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik A G 3: 90,058,631 T163A probably benign Het
Adgrg7 C T 16: 56,750,406 probably null Het
Ahnak C A 19: 9,000,148 Q17K probably damaging Het
Cacna2d3 T C 14: 29,063,918 Y604C probably damaging Het
Carf A T 1: 60,139,232 E268V probably damaging Het
Dmxl2 C A 9: 54,393,702 R2375L probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fer1l6 A G 15: 58,564,077 K440E probably damaging Het
Grin2a A T 16: 9,644,223 F682I possibly damaging Het
Irf3 C A 7: 44,998,700 probably null Het
Kif1b C T 4: 149,220,541 probably null Het
Pcdha5 A G 18: 36,961,476 N346S probably damaging Het
Prex2 T A 1: 11,181,962 V1077D probably damaging Het
Rptor T C 11: 119,865,594 L71S probably damaging Het
Timeless A G 10: 128,248,458 T791A probably benign Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Vrk1 A G 12: 106,051,793 Y107C probably damaging Het
Yeats2 C T 16: 20,186,301 P400S probably damaging Het
Other mutations in Trim58
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02351:Trim58 APN 11 58651350 missense probably damaging 1.00
IGL02358:Trim58 APN 11 58651350 missense probably damaging 1.00
IGL02792:Trim58 APN 11 58640466 utr 5 prime probably benign
IGL02794:Trim58 APN 11 58640466 utr 5 prime probably benign
IGL02875:Trim58 APN 11 58640466 utr 5 prime probably benign
IGL02934:Trim58 APN 11 58640466 utr 5 prime probably benign
IGL03083:Trim58 APN 11 58651390 missense probably benign 0.01
IGL03213:Trim58 APN 11 58651167 missense probably benign 0.00
R0011:Trim58 UTSW 11 58643120 missense probably benign 0.02
R0011:Trim58 UTSW 11 58643120 missense probably benign 0.02
R0735:Trim58 UTSW 11 58651393 missense probably benign 0.16
R1294:Trim58 UTSW 11 58643127 missense probably benign 0.28
R1929:Trim58 UTSW 11 58640667 missense possibly damaging 0.84
R2104:Trim58 UTSW 11 58643138 splice site probably benign
R2311:Trim58 UTSW 11 58643108 missense probably benign 0.02
R3432:Trim58 UTSW 11 58646961 splice site probably benign
R4270:Trim58 UTSW 11 58651267 missense probably damaging 1.00
R4450:Trim58 UTSW 11 58651365 missense probably benign 0.03
R4841:Trim58 UTSW 11 58651324 missense probably damaging 0.96
R4842:Trim58 UTSW 11 58651324 missense probably damaging 0.96
R5262:Trim58 UTSW 11 58651668 missense possibly damaging 0.88
R5979:Trim58 UTSW 11 58646083 missense probably damaging 1.00
R6101:Trim58 UTSW 11 58651615 missense probably benign 0.01
R6684:Trim58 UTSW 11 58651620 missense probably benign 0.00
R6747:Trim58 UTSW 11 58651264 missense probably benign 0.02
R7126:Trim58 UTSW 11 58640579 missense probably damaging 1.00
X0026:Trim58 UTSW 11 58645969 missense probably damaging 1.00
X0067:Trim58 UTSW 11 58647105 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- ACGAGTACATGGTCCTGTCC -3'
(R):5'- TCAGAATGTGAACCACCCG -3'

Sequencing Primer
(F):5'- GAGTACATGGTCCTGTCCTCTCC -3'
(R):5'- CCTGCAGAATAGGCGTTGG -3'
Posted On2015-01-11