Mutagenetix > Incidental Mutation

Incidental Mutation 'R2984:Lnx1'

257766

Institutional Source

Beutler Lab

Gene Symbol

Lnx1

Ensembl Gene

ENSMUSG00000029228

Gene Name

ligand of numb-protein X 1

Synonyms

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.086) question?

Stock #

R2984 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

74753108-74863573 bp(-) (GRCm39)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 74846083 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 122 (C122*)

Ref Sequence

ENSEMBL: ENSMUSP00000113035 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087161] [ENSMUST00000117388]

AlphaFold

O70263

Predicted Effect

probably null
Transcript: ENSMUST00000087161
AA Change: C122*

SMART Domains

Protein: ENSMUSP00000084405
Gene: ENSMUSG00000029228
AA Change: C122*

Domain	Start	End	E-Value	Type
RING	45	82	5.82e-6	SMART
low complexity region	97	107	N/A	INTRINSIC
Blast:PDZ	157	264	3e-33	BLAST
PDZ	288	363	5.33e-19	SMART
PDZ	395	468	2.27e-13	SMART
PDZ	517	594	8.27e-16	SMART
PDZ	647	724	5.71e-19	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000117388
AA Change: C122*

SMART Domains

Protein: ENSMUSP00000113035
Gene: ENSMUSG00000029228
AA Change: C122*

Domain	Start	End	E-Value	Type
RING	45	82	5.82e-6	SMART
low complexity region	97	107	N/A	INTRINSIC
Blast:PDZ	157	264	3e-33	BLAST
PDZ	288	363	5.33e-19	SMART
PDZ	395	468	2.27e-13	SMART
PDZ	517	594	8.27e-16	SMART
PDZ	647	724	5.71e-19	SMART

Coding Region Coverage

1x: 99.4%
3x: 98.6%
10x: 97.0%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane-bound protein that is involved in signal transduction and protein interactions. The encoded product is an E3 ubiquitin-protein ligase, which mediates ubiquitination and subsequent proteasomal degradation of proteins containing phosphotyrosine binding (PTB) domains. This protein may play an important role in tumorogenesis. Alternatively spliced transcript variants encoding distinct isoforms have been described. A pseudogene, which is located on chromosome 17, has been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit an increased percentage of B1-like B cells in peritoneal lavage when compared with that of controls. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 12 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actl7a	A	G	4: 56,744,531 (GRCm39)	I353V	probably benign	Het
Chil4	G	A	3: 106,111,043 (GRCm39)	P284S	possibly damaging	Het
Csmd1	C	A	8: 16,003,782 (GRCm39)	G2591C	probably damaging	Het
Lrp2	A	T	2: 69,256,158 (GRCm39)		probably null	Het
Ncf4	A	G	15: 78,146,520 (GRCm39)	K317E	probably benign	Het
Or4d2	C	T	11: 87,784,572 (GRCm39)	M59I	possibly damaging	Het
Pafah2	A	G	4: 134,139,182 (GRCm39)	E196G	possibly damaging	Het
Pkhd1	T	C	1: 20,293,185 (GRCm39)	N2812D	possibly damaging	Het
Sf3a3	A	T	4: 124,612,202 (GRCm39)	K153M	probably damaging	Het
Tex2	C	A	11: 106,437,489 (GRCm39)		probably null	Het
Tnxb	C	T	17: 34,897,636 (GRCm39)	Q804*	probably null	Het
Vmn2r79	A	G	7: 86,651,099 (GRCm39)	H166R	possibly damaging	Het

Other mutations in Lnx1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00965:Lnx1	APN	5	74,846,378 (GRCm39)	missense	probably benign	0.00
IGL01538:Lnx1	APN	5	74,780,816 (GRCm39)	missense	possibly damaging	0.50
IGL02351:Lnx1	APN	5	74,788,027 (GRCm39)	missense	probably damaging	0.97
IGL02358:Lnx1	APN	5	74,788,027 (GRCm39)	missense	probably damaging	0.97
IGL03011:Lnx1	APN	5	74,846,420 (GRCm39)	missense	probably benign	0.02
IGL03188:Lnx1	APN	5	74,780,924 (GRCm39)	missense	probably damaging	1.00
bobcat	UTSW	5	74,846,351 (GRCm39)	missense	probably damaging	1.00
Caracal	UTSW	5	74,766,710 (GRCm39)	missense	probably damaging	1.00
R0490:Lnx1	UTSW	5	74,781,008 (GRCm39)	critical splice acceptor site	probably null
R0714:Lnx1	UTSW	5	74,768,570 (GRCm39)	splice site	probably benign
R1343:Lnx1	UTSW	5	74,758,040 (GRCm39)	missense	probably damaging	0.98
R1533:Lnx1	UTSW	5	74,780,678 (GRCm39)	missense	probably damaging	1.00
R1681:Lnx1	UTSW	5	74,846,071 (GRCm39)	missense	probably benign
R1714:Lnx1	UTSW	5	74,768,398 (GRCm39)	missense	probably null	1.00
R1727:Lnx1	UTSW	5	74,768,577 (GRCm39)	splice site	probably null
R1806:Lnx1	UTSW	5	74,766,710 (GRCm39)	missense	probably damaging	1.00
R2091:Lnx1	UTSW	5	74,780,727 (GRCm39)	missense	probably benign	0.25
R2879:Lnx1	UTSW	5	74,780,784 (GRCm39)	missense	probably benign	0.03
R3790:Lnx1	UTSW	5	74,789,027 (GRCm39)	splice site	probably benign
R3953:Lnx1	UTSW	5	74,766,750 (GRCm39)	missense	probably benign
R4509:Lnx1	UTSW	5	74,780,853 (GRCm39)	missense	probably damaging	1.00
R4510:Lnx1	UTSW	5	74,780,853 (GRCm39)	missense	probably damaging	1.00
R4511:Lnx1	UTSW	5	74,780,853 (GRCm39)	missense	probably damaging	1.00
R4575:Lnx1	UTSW	5	74,846,204 (GRCm39)	missense	probably damaging	1.00
R4583:Lnx1	UTSW	5	74,771,457 (GRCm39)	missense	probably benign	0.16
R4624:Lnx1	UTSW	5	74,821,121 (GRCm39)	intron	probably benign
R4647:Lnx1	UTSW	5	74,771,457 (GRCm39)	missense	probably benign	0.16
R4648:Lnx1	UTSW	5	74,771,457 (GRCm39)	missense	probably benign	0.16
R4877:Lnx1	UTSW	5	74,788,784 (GRCm39)	missense	probably benign	0.01
R4883:Lnx1	UTSW	5	74,768,530 (GRCm39)	missense	probably benign
R5256:Lnx1	UTSW	5	74,846,315 (GRCm39)	missense	probably damaging	1.00
R6169:Lnx1	UTSW	5	74,838,230 (GRCm39)	missense	probably damaging	1.00
R6185:Lnx1	UTSW	5	74,846,269 (GRCm39)	nonsense	probably null
R6408:Lnx1	UTSW	5	74,846,307 (GRCm39)	missense	probably damaging	1.00
R6476:Lnx1	UTSW	5	74,768,541 (GRCm39)	missense	possibly damaging	0.52
R7083:Lnx1	UTSW	5	74,788,846 (GRCm39)	missense	possibly damaging	0.94
R7085:Lnx1	UTSW	5	74,788,846 (GRCm39)	missense	possibly damaging	0.94
R7261:Lnx1	UTSW	5	74,838,175 (GRCm39)	nonsense	probably null
R7511:Lnx1	UTSW	5	74,780,972 (GRCm39)	missense	probably benign	0.01
R7574:Lnx1	UTSW	5	74,846,099 (GRCm39)	missense	probably benign	0.33
R7670:Lnx1	UTSW	5	74,846,351 (GRCm39)	missense	probably damaging	1.00
R8145:Lnx1	UTSW	5	74,846,060 (GRCm39)	missense	probably benign	0.22
R9015:Lnx1	UTSW	5	74,780,783 (GRCm39)	missense	probably benign	0.00
R9224:Lnx1	UTSW	5	74,766,810 (GRCm39)	missense	probably benign	0.37
R9321:Lnx1	UTSW	5	74,780,991 (GRCm39)	missense	probably damaging	1.00
R9340:Lnx1	UTSW	5	74,758,584 (GRCm39)	missense	probably benign	0.01
R9704:Lnx1	UTSW	5	74,780,879 (GRCm39)	missense	probably benign	0.02
Z1177:Lnx1	UTSW	5	74,788,102 (GRCm39)	missense	possibly damaging	0.80

Predicted Primers

PCR Primer
(F):5'- TCTCTTCCCTGGTGAGAGAG -3'
(R):5'- AAGCATTGCTGGACCCTCTG -3'

Sequencing Primer
(F):5'- CTCTTCCCTGGTGAGAGAGAGAGAG -3'
(R):5'- ATTGCTGGACCCTCTGGACAC -3'

Posted On

2015-01-11